CR00762

CRIMIC CR00762

Gene Wee1

CG4488

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80647

Images

Construct Sequences

sgRNA sequence
TAAGCTGGGATGGGTTAAAGTGG

Amplicon 5' Amplicon 3'
TTGGGCAGGTAACGACAGTCTCCCTCCTCGACGTAGGGTTCCTTAACGGAGGTCACGTGTCCCAGGTCGCCGATCTTGTACGTAACCAGATTCTCTGAATGGCGCAGTTCTTCATAGACGCTGTCCATGCCATCGTCATCTTTGGTCTGCTGCGGCTGCACCTCCACCAGCTTGTGTGCATTGGGATTCATGGTGGAGAATATGTTTTCGGGCTTCAGATCCATGTGCACCAGGTCATTTGAATGAATATAGCGTAGGCCCTCTATCACATGCATGAGAACAATCTTTAGCTCTGCCTCACCCAAACAATGATCTTGGATGCGCGCGTGCAAGCTGCCACCATCGCAGAATTCATTCTGTATCAGCATATGATCGTCCTCCGCCCACGCGGAATAGTATCTAACCACGTTATCGTGCTTGCCCAATACAGCATGGGCCCAGACCTCGTTCAGGGCTCTCTTTCTGCAAGCAAATAGATTGTTAAACGACGCTCGTTGCAATAACTAATGAATACTCACTCGAAAGAACTGCCTGCCACCGGCTTCTTACTCTTTTTAATCGCATATATGCAGCCATCTAGTCGATTGACGCATTGGAACACCACACCGAACTCGCCAACGCCGATTACGTTGACTTGCATGAACTCCCGCTTGAAGCGACTGATGTTCGTGTCGTGCAGGGCCAGCCGCTTGGGTGCCTGCTGGTGGATTTCGCGCATCGAGTCGCCCGCCTCCTCCGTCACATCGTCGTCGCAGGCATCACTGAGCAAATACTTTTGCATAGCATTCACGTTCAGGTTGAGGTTTTCGCGTCCGAATTGCGTGCGACAGCGCTTCTTATTGTGAGCCATGAGGCCTAAAAATAAAAAAAATGATTATTAGATTGCTAATAAGACTAAGCTGGGATGGGT TGGAGTGCAAATTAAAGCAACGAACTGGAAATTGATACCTTTATTTAATTAAAATATCAAAAGCGAGAAACGTTTTAAACTTACTATCTGGCGTGAAGGGGTTCACATTTGCCGTGTCCTGGGTGGGCAGTTTGCGGTTGTGCAGTGGCAGAGATCGCGGGCGCTCTGACAGGCGGAAGAGGTCGTCGCTGCGCCTGGAGGCATTCACTGCCGCTGCTGCCGCCGACAGATGGTTGCTGCACTGCGTCGTCGACTTCTGCAGGATGGTCTTTGGAGTGGCCGGTGTGCTAAAGAGTCGCAGGGCCCGCACCTTTTGGCATGGCGGCGACATGGACACGTCCCCGTCGCCGCCTTCTTTGCCTATCTTACTGTCCAGCTGCTGCTCCTCACCGGAGGATAGCTTCGGCCGCTGCTGAAGGGGATGCTGCGGACTCGCTCCCTCGGGCGTGTCCTTGTCAAAGTCATCATCGGCGAAGCGGAGCTTGCGCGGATTGAAGACCTGCGGCGATGGCGAACGCGATCTCAGTTCGACGCTTGAATCGAGTGAGGTGACGCTCATCTCGTGCTCCGACTGGCGGAATGCCATTGTTGCTGTAGCTGTCCAGCTGACCACGTTGAAAGACGATTCTGTTCGTTATTTCTGATTTCAGAACTATTTGTATGGAAGCCGGCGGCAGTAAAGTAAAGGCAATAGTTAAAAAAAATGCAAAACAAAACACAAAACAAAATTTAACTGGAGGAATGCTAGTCTAATAATGTGGCCGTACCCGATG


Search Again