CR00761

CRIMIC CR00761

Gene Arf51F

CG8156

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band80646

Images

Construct Sequences

sgRNA sequence
AGGGTTCTCGAATTCGATTGTGG

Amplicon 5' Amplicon 3'
CTAACGGGCACATTGCTTCGTGTATGTGTATATAAATACAAGAAGATTAGTGCAAAATTGTTGTTGTTAGTTATAGTTTTTTGGCCGCCGTGTGCTAGCAAATGCATTTTATGCCCCGGCCCGCGCACTTTGGCACTACATGTTAACGGATTTCAGGCTGGCGTGGAACGAATTGGGCTGGAAAGCGGTGCGTAACGGCGGTCGTCGGAGACTTGGGTGTGTATACATGTGTATGTGTGTTACGGGCGTGTTTGTGACGTAGGCAAGCAGCAGCGAGAGAGCGAGCGAAATTCCGTAGAATCCGAAAACCATCCGATATCGTTGCTCCCAAGCCGGCTTTACTGGGTCGTCGAGGGGTGCGGTGGCTGTTCAGGGGGCGGGGGTGGAGCGGTCGGATCCACCCGCCCATTCAGTGGAGCCAGCGATAAGCCCGCAATTGAGATAACTCTGCCTCAATTTGCGAGACACTATAGTGTGTTTATCTGTCCAATTGTACTTCCTATGTGTAAGCATGTGTGCGTGTGTTTGTGTGTGCGACTGTGTGCTGCAAGCTCTTCACTGATAAATTCTGCCTCTCCACTTTTTTCTCGCTTTTTAGCAACGAGCTGATGACAATGTAAGTGAAATTATTATGCAAAATAATGGTCTTAGCTTCCGCCGTCGTACAAGCTCTATATGGCCACCAAATTGCCTGTGCCCGCCGTATGTGTACATATGTAGCTACATTTGTATGTTCATATATCACTTACGCGCCTTCGCGCGACGGCGTTCTTATATCATAAATTGATATGTTAACTGCAAACTGTATTACAATGGCCCTATTATCTGGAAATTCACTGACCCTGCCCTGAATCTCGCCCAGCTATTCTTATCGATATGCTTATTTGGAAGACCTCGCCAACTCTACTCGAACTGTTTTTCAGATTGGCTAAGGTTTAATGGATGACACATCAGCACCATGGGAAAGTTACTATCAAAAATTTTCGGCAACAAGGAAATGCGAATTCTCATGCTCGGACTGGACGCGGCTGGAAAAACAAGTAAGCACATAAACAATAAAGGGTTCTCGAATTCG TGTGGGCCTGATTAGTACCCATTAGTTTCATCAGTTTCCTAAGTGGAAACCAATCCCATTTAAAAAATACTCTTGAGGCGAGGCAATTATTGTTTTGTTTTTATTCTTATTGTACTTTGAAAAAATGTACAATATAAAGACCTTTCAATACGTACACCAGTACTATCACTAATCGAATTCGAGCTATTTTGTTTATACATCCTTTGCGTGTCTAAAGTAATATTGTTTTTGTCCACCCACAGCGATTCTGTACAAACTGAAACTTGGCCAATCTGTTACAACGATACCCACTGTGGGCTTTAATGTGGAAACCGTCACCTATAAGAATGTCAAGTTCAATGTGTGGGACGTCGGTGGGCAGGATAAGATTCGACCGCTATGGCGACACTATTACACGGGTACACAGGGTCTGATCTTCGTCGTGGATTGTGCGGATCGGGATCGGATAGACGAGGCGCGCACGGAGCTGCATAGGATAATTAACGATAGGGAGATGCGCG


Search Again