CR00760

CRIMIC CR00760

Gene Mtor

CG8274

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80645

Images

Construct Sequences

sgRNA sequence
ACAAGAAGCGGTATCTGAGCCGG

Amplicon 5' Amplicon 3'
TCGCTTGGTTTGGGTTTTGCATTCGTTTATGTTATTAAATAAAGTCCTTTCTTTTTTTATTCGTAATAAAAACGGATTTTTCAACCACGTTTAAAAAATTTTTTTTATGAATGAATTTATCTCTTTTTAAAGAAAAACATTTTGTTTTATTAGGCTGTGAATAGGCTGTTATAACGCTGTTGAAACAGTGAGAATAATATACTCGAATCGATAGTACCGAAAAATATCGATATTGTTCCATCTCCACTGCATTGACGTTCATTTTTTCGCGTCCCTAAAGCGACTTTGTGCACAATTCGCAAAAAATTAAGACTAAAGTAAAGTAAAAAGTAAGAAAGTAAACTTCGCACCGCTCCATATAAATTTAACCGCTGCTTGACAAGGATCAACTGCGAACATGGATCTCAGTGGTCCACAAACTCTGAACAACATACTTCAGCCCGACGAGTTGAAACTCGTGCCGGAAGACGTCCAGAAGAAATTGTCGGAGTACATCAACAATTTCTCAGATGAGTACTGCAAGAACCGTGCGGCCGCCAATCGGTTGGGTAAGTTTTTATATTTGTATATATACTAAAATGCGCCATATTTTGCAAATAACCCTTTATTTGCATGCGTATGCTTTTACCTCCAACTTTGCGGCGTTTACCGGCTCAGATACCGCTTCTT GCTTCTTGTAATAAGCAATCCGCGACTGTATGGTTTCTAGCGTGGTAAACACTCTTGCGCCATTTACATATTTTTTGTATAGAAATTTAAATATAAAATTCCGGGTTGTTGCAATTAAAAACAATGGCTGCTTGCAGCAACATTATTTTCCTTATTAATTTTCACCTCACCGGTGTGGTAACACTGGCCGGACATTTTCCCACCAAAACAGTTGATTAGTCCGAGTTTGAAATCTTCAGGGAATTTCTGTGTATTCATTTTAATCCAAATACTTTGTGGTTACTTAAATCCAGTTAAGAAGATTATTTATTTTTGCCCTTTTCACAGCCGAAGCCGAGCAAAAAAAGGAAGAGCTGGAGAACAAAATGGAGGACTATCTAGTAAAATTTACCAGCTTTGAGTTAAATGTAAACGAGCTGCGCACTCATCTAGATCAGATGTCTTCGGAACGAGTTAACCTAATGGACACGATCGCCAAAGGCGAGCAAACTATATCACAGTTGCGCAAGGAAAAGGCGTCGGTAGTTGAAGAACGCGATTCGATGATGAAGGTAATCGAGCGCCAACAAGCGGAGCTGGAACGATTGAAGCAGGATCTGCACACCTACCAGCAGCAGCTGAGCAGCGCGATTGCTGCCAAGTGCGAAGCCATTGCTCGCGTGGACGAAATTCAAAGTAAGGAAGTGGCTCTGGAGCTCAAAGAGAACCGCATGGAAAGCGAACGCGATATGCTGCACAAGGAGATTTTGTTAATCAGCGGAGATCTGAACAAAAGCAACGCCGAGTTACAGAACATCCGACGGGAGCACACAATAAACACCATGCAGCTACAGTCTTGCCTTAAAGAAAAGACCGAATCGCTAAAGCTGATGCAGGAACAGTACGAACAGGCCGTCAAGACCATCGGGGAACTAACCAGCAAGATTGAAATGCAAAACGACACCGCCTTCAAGCAGAACCAGGCCACGGAAGAGTATGTGGGGAAGCTGAAAAAGGAACTTGATGCCAAAGAGAAGCTTTTTGAAATCTTTAAGAGCACCGAATCCGATCATCTGATCCAACGGGAGGAACTCCTACAGGGCATCTCCGAA


Search Again