CR00756

CRIMIC CR00756

Gene CG7102

CG7102

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80643

Images

Construct Sequences

sgRNA sequence
TTGCCTGTTCGGACGAATCGAGG

Amplicon 5' Amplicon 3'
TTCGTGGGACTGACGTTCTGTATGAGCGTGATGTTGTCGCCCTTGAGCATGATCCTCCCGAGGTTGCGGCGCTGCCGGGTCTTCACATAGACTTCCTCGGCGTCGTCCAGCACCAGATTCATGTACTCATCGAATCCCACAATGTGGCCCTCGATGCGCAGCGATATGTTCTCGTATAACCAAACTTGCACGCGGGACCGGTTCTGCAGGTAACGGAAGATCAGGTTGATGGGCTGCACCATCACCTTCTGCACCTTGGGATTTCCTTTGAACGACATTTTTGCTGATTTCCGACGACTTAATTTGAGTTAAACAAATTTTCGCTTCTTTTTGCCGGCGTCTTCTTTTCGTCCAGGCGATAGGCAGAAATATCGATGGCACAGCACAGATGGTCACACATAATCGCGGCCTACCGAACTATCGACCAGCCTAAAGATACCAAAATGGTAAATCCTCTGGTAGCATAACCATATCGATAGAAACACTATCACAATCGCACTGTTAAGTTTTTGTGGTTGGGCAGAAGTTGTTGCCATTTATTCATAGCTGAATTAAACTATAGTTTATAAAGAAAACCAAACAAATGGCTATGGCTAATGTGGACAAAGGTGAACTTATGGACCAGGTTAAGCAACAGATTGCTGTTGCGAATGCCCAGGAATTGCTCACGCAAATGACCGAAAAGTGCTTCAAAAAATGTGTCAATAAGCCGGGAACTTCCCTCGATTCGTCCGAAC CGTCCGAACAGGCAAGCTATACATATCTTATTTTGCACTATAGAATATGTATTTAAATAGTATTTCATTAATATCCAATTTAGAAATGCATTTCCATGTGCATGGACCGGTTTATGGACTCGTGGAACCTCATTTCTCGGGTGTACGGCCAAAGAATACAACGTGAACAATCCAAGTTCTAAACACACGAATCGGCTTCTGCATTTTGGAGCAGCTTGGGACTAACTATATCTGCCAGCTATTGATTAGTTGTTATATCTAAAGTTTGATAATGCAATAAAAACATGCATTGCGTGTTACGTGATTCTGATAACACAACGTGCATATGTTTTTTCTTATCGATATGTGATGTGGTACAAAAAATACCAAAACTTTCAGAATGGTTAGTCTCAATACATTTGACATAGCATATTATGTAGAATGTATAAAGTGTTTTGGCGCGAATATGCAACTTCACATAATTGCTTACTTTTAAAGGTGTGATTTTCTAAAAGAGCTACTCAATATTACTAACCTGCTTTTTCGTGTATATCCATAACGGCGGTTAAAAATGTGCAGGCATTATCCACCGACAATGTCGATATAACGTGATCCTCGCAGGCAGTTCGTAGCTCAACCACACCGATATCCTGTGCCAATATCATCATTTGAAATACTTGCGAGTCCTGGAGAACCAACTGAAAAATGAATTTTGGTTATAATTTTATTATGTTAGATGTTACTAATAAGTAGTTTTCTTACCTTTGCGGTGTAAACGTACAAGATGAACTGCCTGAATAGTTCCGGATTCACGTGTGGTAATCGTATGGTGGTCGGAGTTGAAGCTCCTGGGGCTGCTGGCGATACTGTGCATCCGGGAA


Search Again