CR00754

CRIMIC CR00754

Gene CG17059

CG17059

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80642

Images

Construct Sequences

sgRNA sequence
TTCGATGGGAAGCTATGTTGAGG

Amplicon 5' Amplicon 3'
AGAGCGGCTAAGAGAATCGCATGATGATCACAAATAAAGTTTTAAATATATCTAGAACACTTCTGTATTGTTTAAGAGCAGGAGGGGTGAATTAGAAAAGCATTTTGGAAGAATTACTTGACAATGGTGATTTATAGTTAACAAAACAATTCGAAATGCCTTTATATGCTTAAAGGATATTTGTTTTCGGGTGCCGTGTAGTGTACATTTATCAGTTTGAGGCGTTAGCCTAATATCAAGAAAATCCTAGGTAAAGTGCAGCAGGATTCACTTCTTCAGCTTAATGAACTTCGAGGCGAATTCATAAATGCCCACAGAGTTGTTGTTCTTCTGGTCGTACTCCACCCAGTCGTCCTCGGACAGGTCCACCTCCTCGAACTGCTGGCCATTTTCAGCGGATGAGACGCGCCAACCGACGCGCGGCGAGAATTCGACGGGCTCTGCGCCGCGGCACTCGAAGACCACGATGGTCTTAAATGCGCCAGAATCGTCCGCCGTGTAGGGAGCTGTGTGGATGGATGCACTCAGTAGTTTGGTGGGGATACGTTACTCAAAGCCAGCCTACCATTCGACTTGTCGACGATGTCGATGCTGTTCTCCCGGCTGCACATCTTGCACTTCATGAAGAAGTTAAAGCCGGCCGCATTGCGCGAATCCTGTTGCACACGTTCGGATTCCGTGATATCGTGCCACTTGTCCGACTGCTCGCCGCAGTTGCTGCACTTCAGCTTCAAGAAGAAGGAGTAGTCCGGATGAGACGTCTCCAGCTTGTCCACGTTCTCCAGCGTGGCGGAAATCTGAAGGCCCACACGAACCATTTTTACAATAGTTAATATTTATATTGAAGTTCTTAGCGGCAATCAGCTGTTTCATAGGGTTGCCGGACGGGTACCTATTTTCTGTGTGTCATTGCAGTGGCAACGCCTTCAGCAAGTAAAGATTTTTCTGCGCTAAAAAAAATAACAAAAAAGATAATTGGAAGCTAAAATAGAAATAAGTATGGATTTAAACATGAAACCGTCTCTGGCTGCCGACGAAATGTTTTCCGAAGGCCCCGGCTACATGGAAAT TCCCATCGAAGAATATGGTCGTCGAAAACTTTGTTTATCCTTGTAGCCAACATTGCAATTAAAAGTAAACAACAATCAGATAAATCTACAATCTTCTTTAGAAGTAGTGTTTCCCCGCAAAACAGGAATATGTATCTTTCATTTCATCTTTTGGCGACTTTATTTATTATATTAATTGTTCCCATGTCCAGAGTTTTCATCAATGCTCATGGCAATATCCTACATAAATGTTAAAAACCTGCCACCATACGCTCATATACATATGTATATATTTATATTGTATTCCTTTAGTCCGGCGGAGCCACAGGAATGATGATGGACCACCTGCCCTCCAACGATAAGCACGTCCACGCTGACTTCTACAATGATTTTGATGATCTGTTCGATGAAGACAACTGGGCCAAGATGAAAACCGATGGGAAACAGTAGAGGCCACCACGCAATAAATGGATTGAAAGATTTGTATTCGCGACTCGTTCTTCTGTCTGTAATTTTACTTGCACAATCAGCGATCATTGGTGTATAAAAAATTGCTTCAACTATTGTTTAATCGCTTATTATATTCATTTGGTTCGTATAACTAAGGTAAATTGCCATGTGAGATAGTGCCGAGGTGGATATGAACTTTGGCTTAGCGTAAATCAACAAAATGCATAATTTTGTACAAAAAAACGAAACTATTAACTAAATTTATCGAACTGAGTTTCAGGTGGAATGAAGCAATCATAATTGAGATAAATACAAATGTACACAATAACCTAATGGATCCGTGGAAGTTGTTAACCAAGTTGTAGGCCCTCTGCA


Search Again