CR00752

CRIMIC CR00752

Gene CG14767

CG14767

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80641

Images

Construct Sequences

sgRNA sequence
ACCCTGCTCAGTGTCACGCAAGG

Amplicon 5' Amplicon 3'
CAGGTTGAAGGCCTTGCAACGACCCGAGATGCGGCAACTTGCCATCTTTAGTTAAATTATTCATCAGAAATTCATCATGAAATTTAATCTGCAGTGCGCCGCAGTATATCAACAATTGTCACTCTGGGGATGAGTCAACCAAACAACAAGCAACCTTCGATTTGCGGAATTGCTTTGTTTTTAAAGCCTCTAACGCCATACATATCTACAAAATGTAAACAAAGAAACCCTTGAGATTGGACAGATTAGAAAAGATAACTCCACTGCTGTCCACACCATAATCAACCCATGTGACGGAGTTTTCTACTGGAAAACGTGACCTGATCAAAGCATAAAGAAAGTAGCGGAACAGTGTAAAATATACACGAATAGCGTAGTGAGACAAATACTATTAAGCAAGGGTTTTTGCTCAACGACTCAAATCTTTTATTGGCCGCAGATTCGCGCTCTCTTAAGGGCAGAGCATTCTCTTTCATTTTCAGAAGAGACATCAAAGGTTTCTGGGTTTCCAAAAACATTGATAACAAGACTGAAAATACTGCACTTTGCACATTTATATCCCTTTTTTTAGCCAATAAAACTAATTTCTTATGAAACTTTTGAAAATTCGACAATGCTTTACATTTCTCCAAGTGTAGCGATTGCTAATGCGAAGTCAGATCTTGTGAAAGGTTAGTTTCGGACAATGGACATGGGATGTGGAAACTTCCGCAGTGGAACCGATGGCAGAAATAAGTTGTTGTGCCAAAAAGCCCCGATGATAGTACAGTATAATTCGCTTAGCTGCATCGATAGTTAGCTGCATCGGCAAGATATCTGCATTATTTTTCCATTTTTTTGTGTGAATAGAAAATAGAAAATAGAAAAAAAAAAATTAAGTTAGCTGCATTTTTAAGTTACCTGCATCGAGGCATTGTGCAAAGTACTCGAGGCAGCTAAGCGAATTATACTGTAGTTAAATTTGATCAGATGACGCAGCAGCGGCCAATCAGCCACCAATTGACGTCACAGGCGGGGAAAGTGCAGAGTTGGCTCGTCTTCGTCTTCGCAAAGTTTTGCAGTCATTGGCTGATTGATTTTTCCCTTGCGTGACACTGAGCAGGGTCAAAGG ACACTGAGCAGGGTCAAAGGTTTTTCGCAAATGCCGCAGGACTGCATGCGTGGGTGTATCTCGATATACACACACGCATGTATGGATTAAAGGATACCCCCCTTGATGCACTTACCAGGTGCCACAATCCGATCATCAAAGTGGCCGTGTGGACATGCAGGCCGAAGCAGCAGGTGAACTCCTTCAGGTGACGGTTTCCGGTGCTGCTGCTACTTCCGGCGGCACCATTGTTGTTGTTGCTGTGGAGCTGGTTGCGTTGGGGACCCATCTTGAGGTGGATCCTAAACATTGCACGCCCCACGAAACTGCGGCTGTGGAAAATGAATGCGAAAACGAAAGCGATAACGATAACGAGTGCAGAAAATAATCAGCAATTGTGGGTGTTTTATTCCTCCCACGGATGTGTGTTTGTGTGTGTATGTGTGTTTAGGTGTAGGTGTGTGTTGCATCTACGAGTATGTATGTATGCATTTGTATTTATGTGTGCCACTTTTTCACGACTGATGCTTTGACCTTTTGCACTACTAATTCGGCAATTGATTCACTCTCCTTTATAAGGCGTACCTTTGATTTGTGGGCCAATGCAACTTGCACTGGTTTTCAACTCCGATTTATATCTGCAGCTCTTGATGTATTCAATTTTATTTAACTGCTGCGCAGCACGAAAACCCGTGAGCACTAATCTCTGAAAGTGGTAAAATGCCGCGCAACACGGTCACACTGACATTATGCGTTTTGCAGAACGGTAACGTTTATACGAGTCATTATTCGCAAATATCATGATATTATACAATAATTTTTGAATTAGATGTCATATAAATAAACAACAAAACGAAGAGATGTAAGCTCATTTATTTCTAAATATTCATAGTTTATGTATTTTGTGTCCCCAAATGTAAATTGATATGTTTTTATTACTATTATTGAAGTTAATATTATTTTTAAAATTTACTTCGAAAGGAGCAACTCAAGATAGGTTTGTGCTTCCGCATCGTAAAGTAAATATTAATTTTAAAAAGTACGGTAAGTGTGACCGGTGCGAACGCTAAAGCGCCAATCCGCAAACATCGATAGCAGCGATGCAATCAAAATACATGCTTTGCTATCGTAGGGTGACCATAACTAAAAGATTTGGAGAGCCAACTGCAGCAAAAC


Search Again