CR00750

CRIMIC CR00750

Gene IFT46

CG15161

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80640

Images

Construct Sequences

sgRNA sequence
TGAGTGGTAAAGAATTTCCACGG

Amplicon 5' Amplicon 3'
GATCTCGGCCAATCCTCCAGGAGGGCATCTATGTCCTTTCTGGGCTGGACATCGTACATTGACTGAGTCATATGCACTTGTTCCACCTCAGTGATCCACTTCTCTATATCCTTGCCCGATCGGGCGGTGGGAACCAGTGATGCGGAGGAGGCGTGACGCGGATTTCGCCCCATGCTGCCACTCAGTACCGACCGAAGTTTCATATTCAGCAGACTGGGCTCACTTTGAGCGCCAGAGGGCTCATCGAGCAACCATAAGCCCAATTTCTCCAAGTGATCGTTCAGATCCTTCTGGCGTTGGGGCTGCAAAAGAGGCGGAGCCTGGACTTTCAGAAGGGCATCCACATCACCCACAGCGGGCACAAACTCGGGGATGAAAGGTTGCAGGTGAAACGGAGTATCGATCGTTTGCGGGGTGTATTTGACGATGTAGGGAAAGAGTTCCTTGAGTTCTCCGGGCACGGACAGATCCTCCCATTTGTCGGCACTCATAATAAAGGATTGATCATCCTGCCGCTTAGATCTTCCTGCTCCACTAGCACTTCCCCTCATGGGAAGCGTTAGCTTTTGATGTGGTAGCTTGGCTCCGCCTCTTGCTCCTCCGGATCCCATTCTGCCACCCATTGCGGCCTCCTCGCTGCCCGAGCTCAGGGTGTCATCCGGTACTTGCTTGGAACTTCGGTTGCTTCCCGGCCGCTTTTGCATGTTCGGCCCGGGCACCAGACCCGTCATTCCCACGCCCATGGTCATGCCCTGGGGCAGCTGCATCTCGCTGTCATCGTCATCCTCGCTGTCCTCCGCCTCGTCATCGTGATCAATGATGTCCTGCAGCAGACCATCGTCATCAGTAGAGTTGTTTTGGAACTGTTGCATGGAAGGAATATGCATATATGAAATTATTATATTCATTGAACAAGAATTGTACGCATTTAAATTGCTCCTTAATACTTATTTTCATTTCGTCACCGTGGAAATTCTTTACCAC TACCACTCACCATTCGACGGTGCCTGCCTGCGGCTGCTCTTCGTACAGCTCCTTCTCCGCCCACTGCTCCTGGTCCACCACCGCCAGCACCACCTCTGCCACCGCCTGTTCCTCCATTTCGGGGCTCCATTTGAACACTGCTCAGGTGCTTGGAGTCGGGTCCGCCGATTGTGATCTCCTCGTCGTAGAAGTTCATGGCCAAGGACCAGCTGCGAGGACCCGGATTCAGATTCAGATTCAAATAGCTCTCCAGCTGCGAGTCCTCTCGAGCTATTCAGTTTCCTTTCACCGTTTTCCTGCCCACTTCCTGGCTTTCCGCGAAATTCGCACAACACTTGTCCCGCAATTTTCCGCTCCTTTTGCAGGTGCTGGGTCCTCGTCCTTGTTTCCTATCTCCAGAGCAGAGTTTTCTTCCTTTTCAGCGTTTTCCGCGTCGTTTTTTCTGTTTTCACTTGCTTACCTGCTGGAAACTTGTCAATTGCTTTGGCCAATGCCGGTGTCGATGTCGATGTGGTCGTCCTGACAACGCAACCCACTACGCTGCACTGCGAGAAATATTTTCGTGTGTTTAAACTGGAAGTACGTATATGTGCATTCATTTTTAAGAATTTGCATTATTCGAAACTGTTGTATATGACAGACAATACAATTATAATTTTTGTACACACGTTTTCTCTCTGTGCATCAAGTGGTTGTTATTGTCATATCCTTTTTGGCCTGCGTAAACATTTACAGCTGAAACAGTTGCCCTTTGTTATGGGCCAGGGT


Search Again