CR00746

CRIMIC CR00746

Gene sbb

CG5580

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80639

Images

Construct Sequences

sgRNA sequence
GTGCGTAAGTGTGAGGAGTAGGG

Amplicon 5' Amplicon 3'
AGAATGCGCGGACTTCTCAATATCCGCGTCCAAGTCGTCCAGCAGCTCTGGTATGCCGCCAATATTCCACTCGTCCTCGTACTCAAAGTTCGTGTCCTTCGACTCGCTCGAGTTGGAGCTGCTCGACGAGGAGAGCGACGAGGAGGAGGAGTTGCACGCGGGGCTCTTGCCAGCTAGTTGTTCTGCGAAAAAGGAGAGATGGATTAGATTGGAGTTGTCGCATTAAAGCTTAGAGGTCAGTGGCGTACTAAATGGGGAGTTGCTGAATTGTATTTAGTTTAAATATTTTTTTAAACGGTCCCTCCAAATTTGTAAAATTTATGATTAATTCATTTAATTTTTATTATATTAATTACTTATTTTCAATTCTTTTAATGAATTAATAATAAAAATGGGGGAGGGGGGAATTCACATTAATCGAAAGGACGCTATCGATTTCTATACACTTCTGTGTGTGTGAAATAGCACTTTTTTCTGTAATTTAATTTGTAACCCCTTAAAACAATGCTGTCTACGCCACTGTTGATAAAAAAAAAGCGAGAGGCAGCGAGAGATTTGCAGTTACTTACTCGTATTTGTGTGCTTCTTGATCGCACTGGAATTGTTGTTGTTATTGTGCCGATTATTCGCCGATGCTGCAGTCGCGTTTGCTGTTGCTTTCGTTTTGTTATTGAAATTCAGCGCTTGATTCGCTGTTGTCGCCGTCGTTGTTGTTGCTGTTCCTGTTGTTGCCGTTGTAGCTGTAGCTGCTCCTGCCGCACTTAAATTAGCTAACAATTTATTATTCTTAATATTGCTTTCCGTTGCTACGTTGCTGCTATTCAGGGCCACCTGCGATTGCACAAAAAAAAAGAAAGAAATCCAACAAAATAAGTTGTAGCTTACATACATATGCATGGGTGTGAGTGCGTAAGTGT AGTAGGGCATGACGTGAAGAAAACTCAAAAAAAAAAACTCAAACAAAAATTGTTATTTCTTTCGCCGCTTTCGCTCTTTACCTTTGCCAACTTCTTTTCCATTCCATAACCATAATTAGTTGATAGTTTTGTGCGTGCGCGTATTTTTAACGCTTCAATTTACAAGAAAAACAAAAAACAAAAACAATAAATAAATAAGCAACGTCGTATTACTCTCGATTATTTTGCGCGAGCCTTCTCCGCGGCGTCCTTTTTCGTTTGGCGGATGAGACTGAACGGAAAACCAAAAAAAAAGTGAAGAAGAAGAGGAAAGAGCCGGAGAGCAACCACCGAAAACGGGTGAAGAGAGGGAGAGCGAGAAAGAGATTATGTGAGCGGAAGAGAAGCGGCGGAGAGACGAAGGCAAACAAAACAAAACGCTTTCAGTGTTGGAAAACGCGAGTGGCAACTGACAACTTTAAGTGCACGTTGATCTTCGTTGTTGTTGTTTTTCATTTTCCACCCTTTGAACTAATAAATCAGTTTCCTGGACTGACCCAATAAACCAACAAACTAAGGAGGAGTAAAGCATGTAGTTCGCCGGTCAGT


Search Again