CR00745

CRIMIC CR00745

Gene ave

CG30476

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80638

Images

Construct Sequences

sgRNA sequence
ACCGTCGAGCCTCGTTGGAACGG

Amplicon 5' Amplicon 3'
ATATGCGAGTCTTAGCGGGCATCGATAGGCCACGAATGTCGTACTAGTGCTTGTTGTCGATATATCGCACACAACTCGTGAATTTCTTAGGATATCGTTTATACCTTTGATTTAAATCAGTCGGATTAGGGAACTTATCGGCCGATTGTGTCACCCCTAATTTACATTTTTTTATATTTACATTACAGTAATACAACTGTAATCGATATCTTGTCTCACACCTAATTAATATCGCCTAGCTACCATCACTATTTGTTTTGTTGCTATTTGCAAATAAATCTTAAATTTCTCGATTTGTTTTTTGTGAAATGGGTGAAGAAACTATTAACTCAACGCAAAACAAAACCAGAACGAAAACTACGCGACCGAAGGCAGTGTACCTGTGGACAGTTAGCGATGTGCTCAAGTGGTATCGCCGCCACTGCGGTGAATACACCCAGTATGAGCAGCTCTTCGCCCAGGTGAGTTGAGCCCACAATCCAAATCGTAGTCCTTGATCTACTTCACTTACCGTCGAGCC GCAGTTCCGTCATTTCAGCACCTCAAAACACAAACAGGAAAATTCCCGGTTACCTTTTGCTAAAATTTAGACATCACTATAACTGCCTACTGATCTTGTTTAATTTCTTTCCATGTACACAGCACGATATAACCGGAAGGGCTCTACTCCGGATCACAGACTCCTCACTGCAAAGAATGGGCGTGACGGACAACCGGGATCGGGAAGCCATTTGGCGGGAGATCGTTAAGCAGCGACTGAAGACGGATATCATGGAAATCCGGGATATGGAAAGGCTCAATATTTACTAGGGTCACGATATACTCGTTTTATTTGCTGTAATAGGAGAATAGTTAATGCGTATTTTGTAAACTTTCTTTTTAAGATTCTTAGACGCCATATCTGGTTTTAGATTAGACAATCATGTATGCTATTAATCAAATATATAAGAGCGCAAAATTCTAGATTAAATTTAAATATTGACTAATTATTGCTTATTGCCCATCATTTTAAATATGAAAATAACCCTAGAATGAGAGATTTCTTTGGTTTTTATTATTAGGATACTGGTTTTAGAGTCTACTAAAGTAAAGACCAGAATATCATTTCTTTGAGATCACTTAAGTGTGTTTCTAATATCAATCACTTATAACGACTAGTTCCTCTTAATCAGATCTCCTTTTCCAGCTTGGGCGAAATCAACTGGACGTCG


Search Again