CR00744

CRIMIC CR00744

Gene Ing5

CG9293

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK80637

Images

Construct Sequences

sgRNA sequence
GAATGGGGTTTCGACGATAGTGG

Amplicon 5' Amplicon 3'
ACGTGCTAGTTTGCGAAGGAAAAAGGCTTATGAATATAATCGGTATTTGGTAATCGCTACTTTTGCAGTTTTCTTTTCCTTGGGCTGAAAAACTTTGTAAACTCCGAATTAAAGGGCATTGATGAATTGAAATTAATCAATCCAACTTTAGAAATATTCTGTGAAAACATCTTTTATGATATGGAATTATTTAACTACAAATTAGTTAGGAAATAAATTGACAAATATAATACTGAAGTTATAGTAGCCGTGGCTTTATTTAAATAGGTAATTTTGTGCTTAATCTAAAGTAGTATTCTAAGTAATCATAAAGGATTGCATCTATTTCTTCTTTCTGTCCTGCGTACACTTGGGACAGAACCACTTGCCCTTTGGCTTTGTGGTGAGGCCAACACAAGCGAAGTGAAACCACTCGATGGGACACTAAAATGGTAGAGTGAAAGATCTAGAACTGACCACAGAGTACATCAAAATCGAATACTCACGTCGGGATTGTCGCAGCCAATCATCTCTCCATAGGACACCTGGTGGCATAGGCAATATGTGGGCTCATTGGGATCGACGGGCATGTCCATAACGTCGCTGGGATGAGTGGCGGCCGTGTGGCACGATTCCTTCTCAGAGTCATCAACCTCGACGGTTTTCTAAATGGGTATGTTAGCAAAATGAGTAAGAATGGGGTTTCGACGA TAGTGGAGGCGTGCATGTACATAAGTGAAAATGCAAACGATATGGAAAACAGTGGATAATGCAGGATTTCTATGGGGATAATCTATAAAAGTAAAGAGTATTCTATTTAGGGTCAATGAAAACTGGGAAACAGTAAACATACTAAAGTTCTAACAATGTATAGATGAGAATGTGGATGGTTTACCTTTTGAGCGCCCCCCTTGCGAGTTTCTTTTTCTTGATTTACCTTGGACTTTTTCTTTTTGCTACCTTGCCCGGCATTGCTGCTCGAATTGACACTGGAATTGGCGTTAGATTGGTTGTTGCCGCGCCCAGTTTCCTCATCCGAGGATGCGGACTTTTTCTTTTTGCCCGTCGTCTTGCTGTCCTTGGTTTTTTTGCGACCTTCTGTACAAATGGAATCAAAGGAAGGGGTCAGCTTGTGGAAGAATAGATACTTTGGAACAGTCTTACTCTTGGCCACCACTTCCTCGGATTTGGCACGCGTGGATGAGGCCTTCTCCTGAATCTCACCCTCGAAGCGTGCTAAATCGTTGTCCAGTCGCCGTATCTGCTTGTCCACTAGTTCGTAGGTCTGAATGGCCAGCTGCACCTTGTCGTCGCTGTACTCCTTGGCCTTTCCGAACAGTGCCTTGATATCCTCCTGGCGCTCCCTCCTCTCATCCTCGCTCATGGCCCCGTTCTCGCCCAGCTTGCGCATAAAGTCCTTGGCATGGCTATCGATGCTCT


Search Again