CR00743

CRIMIC CR00743

Gene CG31715

CG31715

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80636

Images

Construct Sequences

sgRNA sequence
GCATGTCTTAGGTGCACACCTGG

Amplicon 5' Amplicon 3'
TTCGATCCTTGCGGCTACTCCATGAATGGAATCAACGATAAGGTAACATAGAAAAATTTTACAAGAACTATTGACATAAATTCTTTATAGGGGGAGTACATGACAATTCATATTACTCCGGAGAATCAATTTTCGTATGTGAGCTTCGAAACAAATGTGGCTCTAAGTAACTATCGTAAACTTATCAATCAAGTAATCAATACTTTCAAGCCGGGAAAGTTTATTGTAACCATCTTTGCCAATAAGGTAAGCTGTTGCTCCACTTTTTGTATAATTATTTAAAATAATTTTCGAATATTGTGGATCAGTGCTCGTTGGCCTACGAAACTATGAAGGAACTGGAAGTGGAGTACTCACAGGGATCGCACTGGAAACGAACCGACATGCAATGTTGCAACTTTCCATCTTACAATCTTCTGTTTGCACAATATTCCCACAGTGAGAAAACTGGTGATAATTTATAAAATTCCAAAGCCAACAGCAATTGTGATTGTTTTGCGTATGTCTAACAAAATTTATTTTTCGTTCGTTATTAATTATTCAAAATAAATGTCGAATAAATAAAATAATAAATACTACTACTACTAAATAACGTACAATTACTTTTTAAATAGACTGTTAATATAAAATACTAAAATATACCAACACCCTGGATAATTCGCAAATTCCAAATGTAGCAAATAATTATCGGATCTGAACAAGTGTCACAGGCAAAGTTCCATCCCTAGCAGTATTTGACAAGTCGGCCCAAAAGAAAAATAAAAATGAGTGCGATTTCTAATGAAGACATTATTTGGACCATAAAGAACGGAGAGTTCGATGCTGTGCAAGACGCTTTTCAGAATGATGTGCGCTGCTAATACTCTAAATAATTTTGGAATTAATTAATTCTATTTGTATACAGGCACAAAAGGTGAATGAGGAAATCAAGGGCCGTTTTCCAGTACACTATGCAGCAGATTTTGGACAACTGAATGTCCTGGAGTTTCTTATAAGCTTAGGAGCAGACATAAATGTAAGTAGCTCACAATGCCAAATTACTCGGCCATGAATCATTAATGTTTCGTCAGTTACTGGTTTCATATATTAGTGTACATATATACACGTCTGCACCACCTTCATTTGTTTAGTCATAGTCTCAAGCTAAACAAATGAACCAGGTGTGCACCTAAGACATGCCGGTCT GCACCTAAGACATGCCGGTCTTCGTATAATAATAGAACTTAATTGTAATTAACTAATATTTATTGAAGAGAAAGGACAAACATGGTATTACCCCCATTCTGGCTGCCATTTGGGAAGGACATACGAGCTGTGTGGAATTACTTCTAAAAATGGTTTGTGCTTCCTTGTTTCTACATATACGCCAAATAAACATGTTTTCGATTGCAGGGAGCTGATAAAAATGGTTCTACTCCAGATGGCCAAAGCTACCTCGAGGCGGCGGAAAAAGACGAGATTAAGAAACTCCTTGCATAATATGTACATGTCATTTTAGGATACAAACCTTATGTTTCAGTATCAAGTACACTTTTAAATACAGTCGTGTATAGCTTTTAAAAATGTCAACTATTTATTTCGATGCTTTGGAAAAATTGATACAAAAATATTCCACTTTTATATAAACAAAATATTGCGTTTTTTATTATTTTTGAGTATATACACTTTATTTAATATAAAAGTTTTCTGATTTAATCAAAGTCAGCTGATATCAGCTGATCTTTGCCTTAAAAACTGATATGGAATCTCCTATCTGGAATACTAGGAATATCGATAAGTGTTGAAGTGCCGTCACTAGCCAAGAACACGATATTTTCTATTCTCAGCTGTTTCTAAAACCGGTGCGTAGAAATTCGCGCACAATGTTTCAACCCGAAAAACATGGGCTTGAGCCCGACTTTCAGCTTACTAAGTTTACCACCCACACCGGGTGAAGTTGCAAAATCCCCCAAAAAGTACTGGAGAAGTACCTAAGGGGAACAGAAATAGAAAATAAGAATAATGATGGATACCTTATCGGTGAGAGATATTACTTTGTATAATCAGCAGATCTCGAGATTAGCCTAATCATATTTTTAGGCTCTGGAATGGACTGTGCAGTTATACCACTCAAGCGGCACAA


Search Again