CR00742

CRIMIC CR00742

Gene Ppt2

CG4851

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79294

Images

Construct Sequences

sgRNA sequence
CACTGTAAACAATAACAAAGGGG

Amplicon 5' Amplicon 3'
TTAGGAAAGCCCAAGGAGCGTAGAAATTTAGTTATTTGCAATGGCTTCTACAATCTCATTGCTGTAATTTGTACTTCATACTTTTATTTTGATCAGACTGTATTATAAAAGCATATATATAATTATATTTTTAAAGCACCCAATGCAAACTCAATTGTGTTTCTAATGGTCCGCTAAATTATATTGCATTTTATCTTTATTTGAATGTACCCATCCAATTTATGGGACCTATTTTATAAACCTTTCCTTTTAAATGCACACCACGTATTTTAAATTCATCCAATTATTGTACAATGAAGTCTCGAGAAATTTCGAATGCATTTTCAAATTTCGTTCTGCTCATAATTGCGCTCGCAACCCATACATTGCCATTCGCATGTCGGATTTCAAATCCGCACTTTCAGAATTTCCAAAGCGGGTAGCAAGAAGAAGAGCGGCTAATAAAGATACGGATACATCAACAACAACAGTCGGAAATCCATTGTTCCCCACAAAATGAGACTTCGTTTGCAAGTCCTGGTGGCCCTGTTAACCTGCTCGTCCATTTCCGTCTCACTGGCCTACAAACCGGTGGTCATACTCCATGGAATTCTATCAGGAGCCGAATCGATGGCCTCTCTGGTCCGGGAAATCGAAGAGGTT GGCAAGGTCGAATTTGACGCAAACAACGCAGTAGCACTGATAAACTCATTTCGTCCGTTTGTAGTTTCATCCTGGCACTATCGTCTACAACTGCGACAAGTTCAATGGATGGTACAGCTTGGAGAACGCCTGGCGACAGGTCGATCAGGTTAGGGATTATCTCAACGAGGTGGGCAAACTGCATCCAGAGGGCATCATTGTGCTGGGTAAGGCAGCCGATTTTCATTAGAGTATTTTCTTTTAGTTACCAATACTATGCCTTTTTCAGGATACTCACAAGGAGGCCTTTTGGCCCGGGCGGCCATCCAAAGTCTGCCCGAGCACAATGTGAAGACCTTTATATCTCTATCCTCGCCACAGGCGGGGCAATACGGCAGTAAGTGAGATCAAAGTTTAAACCAATGAGTAAATTCTATTTATATAGATGCATAACTGCGTCACATTTTTCCGGGCTAAACTCTTTTAAAGCTTACAAGAAACAAATATATTATGTAACTGTGTTCAAAAATTACGCAGTTGGGTTATAAAACAAAGGGGGATCACAATGGTTCAAGTTTTTATTTTTTGGTAATATTTTCAGCTAGCTTCTTGCATCTAATCTTTCCCGACTTGGCGGCCAAGACAGCCTTCGAATTGTTCTACTCGCGCGTGGGACAGCACACCTCGGTTGGTGGCTACTGGAACGATCCGCAGAGGCAGGATCTCTACCTGAAGTACAGCGAATTCCTGCCACTGATCAATAATGAGAAGAAGACCTCCAACTCCACATCTTTTAAGATGGGAATGGTGCGTCTAAATAAGTTGGTAATGATCGGCGGACCCAACGACGATGTGATTACTCCGTGGCAATCGAGGTATGGTTTACTTAGTCGGATATTATCAAAGGTGAAATAACCACAAATCGTATATATTTCCTCAGCCACTTTGGTTACTTTGACGAGAATATGGATGTGATTCCATTTATTAGGCGACCGATTTTCACCAGCGACTCCATTGGCATCAGGACGCTTCAGGAGGCCGGCAAGCTTATCATTG


Search Again