CR00741

CRIMIC CR00741

Gene Tret1-1

CG30035

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79293

Images

Construct Sequences

sgRNA sequence
TTCGACTCGACTTATATGGTCGG

Amplicon 5' Amplicon 3'
GACCCTGCAACTTCTGTCGATGTTTGGCAGTTGCAGTTGCAGTTTGCATTCGAGCTTCGCTGCGCGTTCGCTGAAAACAGCCTGAAACTGCTTTTGAAAATCGGCATAACGCATTTTCTTTGTCTTTGCCGTTCGAAAACAAACTGATAAGCTTGGTCTTGATCAAACACTTGGGAACAGAATCTCCGTCGCTCGCATAAGCAATATCGGTCCGATCAGCACTCGGTGGCTTCGTGTACGTGCCTGAGTCCCATAAAATCACAGCGAAAAACTATTCTCGAATATTGGAAACTAGTGACAGTGCATAATAACAAGTTTCAGTTGAGTTTTGACGAGCGAACGCGCCAAACGTATTCCATTTCCAAGGAGCAAAGTGAAAGGCAGGAAGCTAACGCTGTATTAGCTACATTCGCCGCTTCGTTGCAAGCCAAAAACGATTTCAGTTCGTGATTCAGTTTAAAGATACAGCACCGCGATGAAGATCCTGATGCGAGCGGACACCCATGTGTCCTTCTCCGTGCCCGTCGAGGAGCCCAAGGCCATTTGTACCTTCTCCCAGGTGCCTGAATTATATTAATTAACAAGTGTGAATGCAATAGTCGTATACTATCAAATACCTATTACTCAGCTAGTGGAAATCCCAAAAGCGAAAATTCGTAAATTTGTAGGCTTATCGCTAGATATTCGGGAATAAAATAAGAAAAAATCAAAAAAATTTAAACAGTGTGAACAGTATTGGGCGGTTTGTGGGCGGTGCAACATTTCGAAGTAAACTCGAATCTCAACTCTCTAGTTTTAATAGTTCCGGAGATCGAGGCGTTCATACGGACATGGCCAGTTCGACTCGACTTA TCGCTTTCGACACACACTTTTCAACGAATCTAGTATACCCTTTTACTCTACGAGTAACTACTGTGGAAAAGTTCGAGTCTTACTAATTAAAATCGTTTTCCTTCCTATTTCCAGGTCTTGGCTGCTCTGAGTGTCTCGCTGGGCTCCCTAGTGGTCGGATTTGTCAGCGCTTACACGTCGCCTGCTCTTGTGTCGATGACCGATCGGAATATCACCTCGTTTGAGGTCACCCAAGATGCTGTAAGTACTATTAAAATGTAATTTGTCGAGGTTAAGTTAACTCTTTGTTCGCATCTCTTGAAATTGTTGGAGATTAGCTAATCCCAAGCTAATAAGTCCCAAAGGAGCGTTTCAAAGTCACACTTTTCCATCGAAACTCGAATTCCCATTCTCAAACGAAGCTAAAACCCTATCTAATCACTTGAAATCTATCATATTGCAGGGTTCTTGGGTTGGTGGCATCATGCCGCTGGCTGGATTGGCAGGTGGCATAGCCGGAGGACCCTTGATCGAATATCTGGGCAGGCGCAACACCATCCTGGCCACTGCGGTGCCCTTCATTGTCTCATCACTACTGATTGCCTGTGCTGTGAATGTGGCTATGGTTCTGTGCGGACGATTCCTGGCTGGATTCTGCGTTGGCATTGCCTCTTTATCCCTGCCCGTCTACCTGGGTGAAACTGTGCAGCCTGAGGTGCGAGGCACTTTGGGTTTGCTGCCCACGGCCTTTGGTAACATAGGCATCCTGCTCTGCTTCGTGGCGGGATCCTTTATGAATTGGTCGATGCTGGCCTTCTTGGGAGCTGCTCTGCCCGTTCCCTTCCTGATTTTAATGTTCCTTATTCCGGAAACTCCGCGCTGGTTTGTGGGCCGTGGTCTGGAGGAGCGCGCCAGGAAGGCTTTGAAATGGCTGCGTGGCAAGGAGGCTGATGTGGAGCCCGAACTGAAG


Search Again