CR00740

CRIMIC CR00740

Gene ssp3

CG18397

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band80635

Images

Construct Sequences

sgRNA sequence
TCTTTATAGCGGGTTTAAGTTGG

Amplicon 5' Amplicon 3'
GAGCGACAATGAACACGAGCCAAGTTAACACAATGCCAACGACCAAAACAACAACTCCGAAGTGCGATGCGCCGTCAAAATATTTTTATAGATTTAAATAAAAAGCAAGAAATTATGTCCTATCAAAATGGAGAAGAAAACCGATTTGCAATACTTTTTCGTCTTGAGAAAATATATATATAATTATACGTGTTGAACGATATTTCTTTAAGCTTTAAAATTACATCAAATATAAAAAACATAAATTATTGTTTTTACTATCACAAAAATCAAATATTTTTGTTTTTACATATTTTTTTTTAATTTCTGTAAATTTGATATATATGTATATTCTATATATATTTATTTTTTTCTGATCTGACCTGATGTTCTCGCGGAAAAAAGGGTACAATTATATAGGCACCAATAAATTTAAAAAAAGGCAACAAAAATTTACATATATTGGGTGGAAGAGTGGCTTTTTATGCGATTTAACGATTGATTTAACAGCAGCCGCAAATGTACATATAAGCATTTTACACGCCGACAAATTGGACAGAAGAGTGAAGAGCTCCAGAAAGTTGAGATCAATGGGGGGCAGGGATCAGGGAACCGACCTAGTGCTTAAAAATTGATGGGCCAGGCGACAGACAAGCGAGCGCACGAGGCCAGTAAATAAAATTCAAATAAAAATGCCAAACAAACAAAAGGCAGCGCCAAATAAAAGCGTCAAAGAAATGACAAATAAACAACGCCAGCGAAACGAGCAAAAACAAAAGCCAGCAAAACATAAACTTTAAACAGGGCCAAAAGGGTATTGCGGGCTAATCGACCACCAAATGCCCTTCCAAACCAATTGGGAGTTACATAAATTTGCATAACTTGTATAATAAAAAAATGTGGTATATATTAATATATATAATAAATATTTATGGAAATATATAGAACTATTCAAAAAACTAGTGTTAAAATAGTGGCATATCTAAACAATTCTGTAAGGCAATCGAATTGAATAATACAAAATAAATATTAACAACTTTTCTACACTTAGTTCACATAAATGGCCATCTCCACGACTATATAGTTGCTGCAAGACCTTCGCTTAATCCTCCGGACTCCCGCCCCACTAGGATTTCTT AGAGACATAAACGCGGCCAAGTGTTAAGTGGCTGCCGGCAGGAATAAAACGCTAGCCAAGTACGAATTTATACCACACACATAGGCGACTTTCGACGTGGCCTGGGGAATTGTGAGTTGCCAACTTTAGTTGGGTCTGCCCCAATCCCACGGACAACGCCTCGAGGCGAGACGACTGCCTGGCGACACTTTTATTGTGGAGCATTTTGGGTGGCCAAAAGTTCGAGAAAGTTTCTTTTGTGCAGCGGTTGCTTTTGAGGATTACCTGGAAACTCTTGTTGATGGCATCGAACAGAACGGTTATGGAATTGCCCAGAAGAGCGTGACGAGCAATCTGAGGACACACGGAACAGGCATTCCGGTACAGCTGCGCGGCCAAATAGACGGACCTAGAGCATTATAAAGTAGCGATATTAACGATATACTCAAAAGGTAAAAAAGTCCAAAGTCAACTCACTTCCGGGAGATCTCTGAGTTTTCATCCATGCCCTTGCTAATCACGTGGTTGGCCAGTATGCCCAAGCCATCCATGCAGAGAAAAGCTAGAAAATCTAAGGTCTGAGCTTTGGGTATGACACGCA


Search Again