CR00739

CRIMIC CR00739

Gene CG5149

CG5149

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79292

Images

Construct Sequences

sgRNA sequence
TCGGCAAAAAAAGAGAAATCGGG

Amplicon 5' Amplicon 3'
TTGGCCCTAATTGACGACCCCAGTCATTGAAATCACGACTAATTCGTTAGCAAGCAAATTCAACAAAGCAAAAGACAAACAGTGAAATGCGGCAGCAAACAAATTAGACAAATTATGGACACGTTCGCACTGGCCCAGGAATTATCAATTCGAAACTGATAACGCCCGAGTTGAAGATATCGAATTTTGCTATACCCTAGGAAGCGCTGTGATAATCAAACACGAGCTATAAATAGATGGAAATATTATAAGGAAAAATCATCATCTGGTTACAAACAAACATTTTTTGAGTGGTTGCATTTCCGTCATCTGTGCTGTGATAAAAATAAAACACAAATCTGGGGCCTTGAACCCGCATCGGAAAAATTATAGCATAAATTGTGTATGATCAGATTGATTTAACTAAATGGGTTAAAATAACAATTTTGGAAAGTTACGTGTACATTTAATCTAAATAGGACTGACTAGTTTAGAAAATTACATTTTTAAACAAGTTGAATAATTTACTTTTTATAAACTCTGTTAAATTTCCTGGTTTGCACTTTAAATCGAAAAAGAACTGTATTAAAATAAGGTTTAGAAACTTTGAACTTTTGTATAATGCCGGATAATGTTGCGACTCACTCTCTTATATAACTAAGCTTCTTTTTCGGAACATAGTACTATGATTAACTTCAATGTTTAATCCTCGAAATAGGAGTTAGTGACAACAACAAATTAATGCCCTAAAGGATATACCCATTCAAGTGAAGGGTGGCCATCGCAGCAGGTGGATGGACGGCCGTTTGTCATGCACTCGAAAGTCCCGATT GAAGAAAGTTCACTCCGCGCGTCCTTGAACTTGTGACCCTGACCCTTCCGCAAATGCAGAATGCAGTTGCCATTGATTTTCGCAGTGCACACGTGGCACGGTAACTGGATTTACTTGACTTACCACCAATCTGTCTTGGGTCAACTTCTCAAGTGCTCCGCCAGAGGCGTTTTTGTACGCGGATTCCAGCATGCGTAGCTCTTCCGAATTGTAGAGATTATCCGTCTCCCGCTTGCCACTCGCATTTCCCATCTCAGGACACGAAATTCAGTTGGCTGGTGCTACGACGGCTGGTAAACAAACAATGCAGCTGCAGCTGCGGATGATCGCGGATTTTAATTGAAAATAAAAAACAAACAACACAAGCTGGTGATGGAATGGCAGTCGATTTCCCTGCGATACCCTCGATAGTTTCGGAAACGGGTAAATTTCGCGGTGGTCGTCTGCACTATGAATGGTTATTGTCTGTGCTAAGTCAGGTCGATGTATTTGCTAAACGGTTAATTTTAACCGCTAAGCGAATTCAACGAAGGCCAAGCGAATAAAATAAATTTTAAATGCCTTGGATAGCTGTAGTTAAAAATTTATTAAAATAAAAAAAAACTTACAAGTTTGAGCTAAGATACCTTTGCCCTAGCCCGGTATTTTTGAAATTATCTCAGTTACCTTAGCAACACGCCTTATTAAATCAATTGCCTGGCCTAATAAAGTTCTCCCACACAAAAACACAATAAATTCCGATACAAAACTGAAGAAAGCTGGCATACCGACAGATATTTCCGGAATACGATTGGCCAAATCTGTGAGTAATCCAACGCGAAAGGATGATTGGCACTAGCAGCGGAACGTCCCACAATCGGAGTCGAAAGAAGAAAGAACAGTGCGGATCCTGTCCCAACAGATTCTCAAAGGATAAGCGCCAGGTGGCCGCCGAGGACTCGGATACCACGGAGGTGGAATCGTCTACGGATGAGGAGGAACGC


Search Again