CR00738

CRIMIC CR00738

Gene NC2alpha

CG10318

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80634

Images

Construct Sequences

sgRNA sequence
TACACGCCTCGCATAATCAGAGG

Amplicon 5' Amplicon 3'
GCTTGTGAGGCGGAACTTTGTTCTCCGGCGGTGGTAGGGGATCGGCGATAAAGCAGTCAAACAGGGGCTTGGAGAAGAAGATCAGAAGTGAGCCTGTGATGAAGGAGATCTGGAACAGGCGTGGATTTCGCTGAATCCACGTGCGTTTGGGTAGCACAGCGGTTCGCCTGCGCTGATTTGCTTGCTGTTGCTCCTTTTGGTCCAGCAAGTCTTGAATTTCCTTCGGAGGCCTATACTGCGGTATGGACATTATTTGTTCCTGCAAAACGAGTTGATAATAGTGTATATGGAATAGAGAAGTTGGCTACAACTCACGACTTGCCGGTTGCGTTCTTTTCCTTGGATGCGTCTGGTAGATAAGTCTTCTCCAAATCGATTCCACTGCAGCAAAGCGATTCCTTGTGCCACTTTAAACAGCACTGGCGCATTGCCTCAAGGACATCCAAGCACTTGTCCTCCTGGTAGTGATTCTCTGTAACCGAGTGCAAGTCAGCTTACATAACCATGAAAATGGAGTCACCGGCGGTGCTTACTGGTCAGACAGGCTTGTATGCGGCAGGCGTTCGGTTTGCAGGGATCCTTGCGAGTGTCAGACATGTAATCCTGCCCAGAATTCTTACGATATTAAATCGCTCTTGCAATATGTGAAAAGTACTTGGAAGTGTTCTGCACTCTTCTTCTTCTTGGCGGTTGTAGTCATTCACAGTGCACGATCAAGGTAGCCAGACTGCGCGACGGTCAGCTGTGTAGGAAACCTAATACATCAAAGCAAAATAAAAAACAATCACATAAATAACAACAAAAAGAAATAACATCTCTTATAATGTACAAAAATTTTTAATCTTTCAAATTTTGATATTAATACCTTTTGCTTCCCTGTGAATACCCCGCCTGCTGCGAGAGCAACTGCCATTCACCCATCGACGCCGACAGTTGGGCACCAAGGAACTGTTCTTGTGTGAAAAACACACACACATTTGTTTTATTTCACTAGGACTCTTGACGATTACTTCACAAATCGGAAAATGCCATCGAAAAAGAAAAAATACAACGCACGCTTTCCGGCGGTAAGTTGAAACCACCGATTGGCGACAGGAAAGCTCCAGCCATTTGGCGGCCGTGAACGCCGAAGATGGGTTATCAGTTTTCGTGCATGTGTACATACATATGTACATACACGCCTCGCA AGTAGAGGAGAAACCAAACCGGTGCGAGATTATAATGTTTCCAAACCATTACCATAAACTCCTTGCAGGGTCGCATCAAGAAGATCATGCAAAGCGACGAGGAAATCGGGAAGGTGGCCCAGGCGGTGCCTGTTATCATCTCACGCACGCTGGAGCTCTTCGTGGAGTCGCTGCTGACCAAGACGCTGCGCATCACGAATGCGCGCAACGCCAAGACGCTATCGCCATCGCACATGAGGCAGTGTATCGTATCCGAGAAACGCTTTGACTTCCTCAAGGAGCTGGTCCGCAACATACCCGACATCAGTGTGGCCGAGGAGGCCGCCTACAACGAGGACGATGTGTTACGCAGCTCGCCAGAGGAACAGTATCCAGATTCAGACACGCCATATGATCTTAGCCTGCCATCGACGTCAATGCGCTCGCAGGCGAACGGCACAGCTGCCTACATGCGCTCCATGAGTCTGAACAACGGAGCCGGATCGGGCGGAGGAGCCGCAGCCACCAAGCGGCAGTTTCAGTCGCAGCACTCCACCCAGGAAACTCCCACCACCAGCACCACCCTGCCCGCCAAGCTGGCCCGCTCCGGGTCCATGCCGGCCTACACGCCACGGGGCAGACCGCCCAATCACCTCAAGAAACAGTCGGTGCAGCTCGATACTGCCATACCCGCCCCGATCTGCAACTACGAACTCAACAAGCCCATTGTCAAGATCGACTACAGCCACGTGCAAATGCCGACGGCGAACCTGTGCACACCGGACGCCTCTGATTCTGGGTCAGGATCGGGCGCCGGATCTGGAGCTTTTAACTTCGACATAGCTGCTCCGGTGATCAATATCGATCTGACGAATATCGTGGCCGGTGGAGCACCTGGCAGTGGTGTGCCCCCCGCCTCTATTGGATTACCAGCGGCCACGCCGGGGGACAACAATAATGTGAACCAAATGGCTGGAAAGAGCAGCGCTCCCATCATTCCAAA


Search Again