CR00735

CRIMIC CR00735

Gene Phlpp

CG10493

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80633

Images

Construct Sequences

sgRNA sequence
GGCTGTCGGTATCCGACATCCGG

Amplicon 5' Amplicon 3'
GGCCCAGAGTCATCATAGCCGTAGTTATCGTGTTCGTCTTCAGTTGAGCGGTCGCTTTTATCGGGTGCGGATATCATATAGTAACATGTAGGAGTATTACCAAATTCAGACAGTTGCCTATTGCCACATCTCGGCAAGTCCCCTTTAAAGAACTAATAAGTGCAGGCAAAAGGTGATATGAATTAGTGACCGAGTGCAGTTAGGTTTTAGAAATAACAGTGTAGTGGATTATTACCCCACTAAAACAAATGAAATCCGCTGCGATCGCCACTCGATGGGTGTTCGTTGATGCATAGCGAAGTTGGAGTCTTTGCCAAGAGCTCGAAGTGAAATAAAAGAAACCCCCAAGAGGGCCGGAACAATGCTCAAAGCCACGAGGAAGCAAGCGGATCCGTACAAATCGAAGCTGAAAGTTAGTGCCAGCCACAGTGGACCGCATCCACTGCCCGTCGAGGTGACGGCGGCAGAGGAGGAGCAGGCCGCCACTTTTGGCCAGACATCCCCCCAGAAGCTCAGCCTGAAGGGCAGCCAACTGGGCGGCAGCATTTTGATTGGCAACTACAATGTGAGTTGACTCCACTCCGGCTG GTACTCCATATCCGGCTGGCATGCCTGTACATCTTCCCCAATCGCCGTTTTCTCTTTTCGTCCGCAGTATTTGACCCAGCTGGAGGTATGCGAAAACGAAATGGAGGTCTTGGATCTCAGTTCGCTCGCTCAACTGGAGACGCTGAAGTGCAGCCGGAACAAGCTGATGGAACTGATCATAAATGGCACCAATTTGCAGACACTTGTCGCCGACCATAATTGTAAGGGGTTCTTATTGAATGTATTCCACATTCTGCATTTAAATCTTAAATAAAAACTTTATCTGTGGCGCCTACGTCTCTATAATCTATTGCTTAATCTTAATCTTTAAGCTTATATTGTAGAAGAAGTAGCGTTTATACGGACGGACGGAAATTGATCCTGAACTTTATAGGGTCTATTATTCTATTAAACTCTCATACTCTATGCGTAATGGGTAGAATTAAAATGAATAGGATTCTAAAACAGTATCACTTCTATTACTCTTCAATAAATTCCAGACCTGCACAACATATCCACAACGAACACGCATCCAGTTCCGCTGAAGTTGCAGCGCATTGACATCTCTCACAATAACTTCAGTGAGCTCCCCAACTGGGTCGGAGCATGTGCCTCCTTGACCGCCATAAATGCTTCACACAATCGCCTTAACAACGTGGCAGTACTGTTACGCAACTACAGGATAACTGAGCTGGTTTCCTTAGACCTGGCATACAACGATCTGAAGCAACTGGACCAATTTCCGGAGGGCTTTTCAAGCATCCGGAGTCTGCAGTTGCAAAGCAATGAGCTACCGAGTCTTCCGGACAACTTTTTTGCCGTGACCCACGCTCGCCTGGAAACGCTAAATGTCTCCTGCAACAAACTGTCCACCCTGCCACGCTACGAACAGAAT


Search Again