CR00734

CRIMIC CR00734

Gene Golgin245

CG3493

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80632

Images

Construct Sequences

sgRNA sequence
TGTGTCGGTGAACTGGGAAGGGG

Amplicon 5' Amplicon 3'
CTGTTCGGACTCCAGCTGTTGGCCGCTTCTCTCCAGAGCCGCCGTAATATTCTCAGGATTTTCGCCCAGCAGCTGGAGCTTCGTCTGATAAGCCTGCATTTTGCAGCTCATGTCGTCCATCTCAACGCGCAGAGCCTCCTCCAAATGCGCCTTGGCCTGCTGCTCCAGCGTGCACTGCTCCCTCAGCTCGCTGATTCGGCGCAGCGCCTTGTCTTGCGTCTCCACCAGCACAGACTGCAAAGCGATATTATCGGAAATGTTCGTTACACAAGCTTATCAAGCAGACCGATTAGATAGGCAGATAGATAGATACCCGCGCCTTGGAGCTGTCGCGTTCCAGTTCCTTGTACTTTTTGGCCAGATCCGTGTACCGACAGCGGTACTTGTGGTAACGATCAAGTGACTTCTTGTACGCATCGTACAGCTGGTCCTTGGTGATCACATCCAGACGAGCCGTTGAGGCGGAGTCGTCGAACTCGCTGCTCGTTTCGTCCAGATCAGATTGCAAGTGGTACACCTGGAAAGTAGAACACATAATTAAAGCAATCTCGGAGACTTTTCGGCCACTTACAGCTGGCGCTTCATATGTAGGCAGGCGGAAAGACACGTCGCTGGCCATGGACGAGTTGGAGAGCTTGCGGGTCCTGGAGGTGGCGCCGTTCAGGGATTGCGTCGATCGTCCGCGCAGAGCGGATGCACTTGTGGCCGGCAGCTTTTGGATGCGATAAGGCGAGTTCTGAGGTGTGTCTGCGCGGTGAAAGATGGATTGATATGTGAGATAAGGAACCCCAGGTGACTCATGGCGTACTCACCCTCCTCCGTGATGCTGAAGAAGTTCTCATTGTTGCTGGTGTTCGTTTCCGAATTGGGTGTTGTGCTCGACGATGAGCTCACGGCGGCCTGGGAAAAAAGTCCAAGGAAGACTCATGAGCAGCTGGTCACTTCACTTTTCACTTGTGCACCCAGAAATGGGTCACAATCGCACAATCG AGTTCACCGACACACATGCAATTCCGTGTCTGTGTGCGTATGTTTTCCTCAATTTGCATTTTTCATCGGCAATAAGCACCGCCCCGCCCCCGCACACAAAAATACCTGTGCAGCATTCGCAAATTGCTGGAACTTCGAGGGCGACGCCTTCACCTCCTCGATCAGCTTGTTCTTCAGGTTGGCGAACATTTCGAGTGCCTGCTGCGCTCTTTTTCAACTGGTTGCGCTACCTGGTTTAAGCACTATTCAATTTGTAATTAAAAAACATCTAAATAAATACGTGTCTGCAGATGTTCATTCAACGGTCACACTGCCGATAGCCTCGGGAGTTATCGATAACAAGCGCAGTATTCATTAGGGACGAACGCAACTGCGGGTCATTAAGTTTATGAACGTGACGAAAAATTTTAATAAACATAAATAAATGTTACGTACAATGTAATTTTTATTTAATACACACAAAAGTAACAATTTAATTAGTTATAATTGATAATACCTACCTCCATGTTTTTTAATACCATCTTGGTTCAAGATATTTTCCACAGGTGGCGCAGGTTATCTTTAAAAATATTTGGAAGCCTGTTGAACGCCCTTTCAATTCTTTAAATATAGATATATAGAAAGTTCCTAGGTATGATGTATTCAATTTTTTCTAACAATACTACTATAATGAACTGTTTACACGCTAAAACTGAATGAAAGCTGGTCAAACTTGCTAATTATGCAATGATTTAGCATTTTAAGTAGCCGCTCGTGTTTGAGGAATCCTCATGTTGTGGGCAAAAACGCTTAGTTAAGCACCCTACAGTTTGTTTTTATTCGAAGATAATGCAGCATACGTTTAAATTGCACTTCTTTATTTATAAAAACCGCGCAATAGTTCGTATAACTGTGTTTTCTTGTACGTGAAATATACACTCTTTTCATAAATTCTATTTTTTACAAGTTGTTATTCTTTTTAAGTTAATTGATTTTTAGTCGATTATAACGGCAGGCGATAAGGCCTTAGTTATTAACGAAGAGGAATTGAAAAATAACTTATAAAGAAACACATCAACGAACTTTATTGCTTTGGTTCTGTAACGAAGCGGCCAT


Search Again