CR00733

CRIMIC CR00733

Gene betaggt-I

CG3469

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80631

Images

Construct Sequences

sgRNA sequence
CCTGGCCACGTATGGAGATAAGG

Amplicon 5' Amplicon 3'
GAGCCGCTGTTCACAAGTTGTTCAATGAAAAAGACTCTTCCTGTTACCTGTTTTTTGCTGCGCTCGATGTATTCCTTGGGCAGATTGGAAAAGTTCTTCAACTTGCTGGCCAAATATTGCGTTAAACGCATTTTGAAAGGTTAATTCAATTATTAATAATAAGAACTAGTAAATTAAATGCGGCTTGCAATCAGCTGTTGAGAACTGAAGAATAGCCATTCACAGGAAGGCCCAACAATTTTATTTATATTTAATGTTTATGCGACTCTAAAGATTATGAACACTTGATGTAGGCTTGTAAAATATTTAAATTAATTATTTTCGAGGTTTAAGAAAATATCTTAGCTTATATATTGTTAAACATTATGATATAGAAATTTAAGAACTAGCAATTATTTCCCCGTGTAAACGTGGTTCGCTGTGACTGGCAAGAAGAGGTAAGAAGAAGCAGCTGCTATTTGTGGACTACTCTTGGTGTTTTATATCGTTCGCCGTAGCCCTAAATTGCAATGCAAACCGGCTTTATATAAACAAAAGGTAAGTGCTAGACCATATAAATGTGGGCACGTGCGGGCGCAACATCATTGGAAGACGGAATCGCAACCGGAGAGCGTCTATTCCGGCCAGCTCAGTCCAACCGTTTGGGAAGGGCCTTTCAACGCTTAGTCATATCCATATCTCAGCGCACACCGAGACAATCCAGTTCCTACCCACCCATAAGTTCCTCATTTAACAAGCAATATGTCCCACCACATAGATATGGAAGACCGCACTGATACGGAGCCCGTGCTGCTCTCCAAGCACGCCAAGAATCTGCTCCGATTCCTTAATCTCCTGCCAGCTCGCATGGCCTCGCACGATAACACCAGGTAAGTGCATCCTGGCCTCGTATTTAACTTTTGGTTAACCATTTCCTTGTCCATCAGGAGCACCATTGTGTTCTTCGCCGTCTGCGGCCTGGATGTGCTAAACTCATTGCATCTGGTGCCGCCACAACTGAGGCAGGACATCATTGACTGGATCTACGGAGGATTGGTAGTGCCACGCGACAACGAGAAAAACTGCGGCGGTTTCATGGTGAGCATAAATTCGCGTCTGTCAGGTGTACAAACAGTCGTTGACAAGCCAAACAGAACCATCTTCCGCTCCCACATCCACTCCCAATCA GGCCAGGTAGCAGACACTGCGGCAGACGTTGTCGCATCCCTTACATATTGGTGTTTATTCAGTCAGTTGATATACGAGCATTCGCATTTCCTTCATTGAGAAGCATCCACGAAGTAAATATTTTGAAAGATTCATTTCCAACAAAAAAAGTATGCAATTCTTTATTAGCATTTATGAAGTTTGTTTTTGTTAAAAATATCTAAGAAGCCACGTCTTGTTTCCCCATCATGCATCACATATTTCATGATTCCAGACCCTTTAGTTTAAATTACAAATCTAAATTTTGTTTTTAAATAATTGGATTCTAATGAAAACCCATTAAATTGTTAATTCCAAGGTCAACGCATCTGCTTTACATAAAAAGCAAAACGGCATTACTTCTGTTACGATCTATACTGTTTAAATATGCATAATTGTAGAGGAGTTCTCCATTTGCGCAGCAGCTCGATTTACCATTACCCACCACACCCCACCCACCGACACCTTGAATTTATCGCGCCACGCTTTATCAGCGACGCCAGCAACATGCAAAACCACTTTAAAATAGATTGATTAATTAATTGGTATCTTTGCAGGGCTGCCGCGCCATGGTGCCCAAAACCGAGGACGCCGAGATCTTGGAGTGCATGCGGAAT


Search Again