CR00732

CRIMIC CR00732

Gene Rbcn-3A

CG3585

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79291

Images

Construct Sequences

sgRNA sequence
CCTCCCTAGCCCACTCGAACAGG

Amplicon 5' Amplicon 3'
CCCCACTGACGACATCACAAAACGTAAAAAACAAAAACCCATTGCAAGTAATTTGCATTTGTGATTCATCTCCGCCCACGCAAATCGATAGGTGGCCACACAGAGACACATAGAAATGGGGTGTTGGGCAGCTATTGGCTTACCCGTGTGCTCCTCCTCCTGCTGGTGAGTGGGCGACTTGCTCTTCCACAGCTGGATGTTGGTGCCGCCAGTGAGGAGGCGGGTGCCCTCCAGATTCCAGGACAGGGTCACCACGTTCGAGTGGCTGGTGAAGGAGCCCGTTTGCACCCATCTATGGGGGTATGAAAAAATAAGTTAGTATGTCTTTGGGCTTCTTAATACCATCGCTAGCTTACCTGTAATCCAGAAAGTGGGTATTGTGTTTGCTCGACTCAATCACCGGCGTGGGCTCAAAAATGCATATCTTATTCTCATAGGCTGCTGCTATTTTTCCGGTATCGGTGCTGCAGTCCAGGGCGGATATCTTGACATAGCCATGGTTGGCGCCCGGAATGATCTGGACGCGCTCGAAAGTGCTTGCCAGGATGACCACATTGCAGCCGGCGGCGTAGGCCTGATAATAGGAGGGGCGAAATGGGGATTTTGTGAGTACTGCAGTTAATCTAAGCGTTATACGATCGGTATGTGTTTTCTCAGTTATTTGTTTTTGAGTGGCTATGTGTATATAGGGCGGGTGGGTATATAGCTTTATATCGATAACAATACCCCAACTGTCCAGTTAACTGGCTTATCAGGCTGGCTGATGACAAGGCTCTTGCCACATCATGTTTGGTTACCTGGTTAGCTAAAGTGTGTTTGATTTATTTGTTGAGCTGTCGCTGATATGCTCATTATCGTGGCCAG GCTAGGGAGGGGGTACACTATTTATAGTGGAAACACTATTCATGTTAATTATCTCTAAAACATTACCGCATGACGATCTGTGGCAAAGGATCATTAGTGCGGGTGTAAAGGGTTGAGTCAGCAGGCTTTATCTTTATAATTGGCTCATTGATGCGGGAGATTACAGATACCCCGTTTAGTTACAATAGCGATAAATGGGGAATATCAACAGAGAATCTGTTTGCAATGGCTTATCGCGATATTGGAATGTGAGCCTTATTTAGCTAGTTAATGAATAAAAACATCATTTCATAAAAACAAGGGTATTAACAACTTCGTCACTACACACTACACACCTGCTAACTTTTTGACATAAAAAGGTTCAACTACTCTGCTTTTCTGTCGTGTTTATATTTAGCTTTTTGCTTTCCGGTTTTCCCATTGCTTTAAATGTCAGCTTATGATGGGTTTATGCGTTTAACTGAGAATATTACCCATTAAGTAAACACACCGATGATACTTTTCAATGGAGGGTTTTCCGAACTTTTCGCTTACCAACCCATTAGTGTTCCCGCGGATAAGATTACTTTATATAAAACTTTGTTACCTGCTGAAAATAAACAGTGATTTTTTTACGGTATCCTATTGTAGTATTGCTATACTATTAAAATTTGACTTTAAATGCGGTTTTAATGAGTTTATTATTTTTGGTTTCCCCTTCCAAACGCTAGGTGGCGCCAGGGGAGTGTGTTCGTGCCGATCATATACTAAATAAATATATGCATACACACATACATCCACACATATGCAAACACTCGAAATTAAACAAATTGAAATGATGGCAAATGATATGGCGCAAGGCGGTGGGCAGTGGGTGGGTGTTGGGTGGTTGGTGGTCGGTCTGTGAACGGGGGACTGTGTCAAC


Search Again