CR00729

CRIMIC CR00729

Gene crol

CG14938

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79290

Images

Construct Sequences

sgRNA sequence
TGAGTAGAAGCAGAGTTGACAGG

Amplicon 5' Amplicon 3'
AAAGCTCTTGCCGCAGATCTCGCAACGGAACGGCGTCTCGTTGGTATGGGATCGCATATGATTGGCTAGGTGCTCCTTGCGCGTATATTTCTTGCCGCAGACATCGCACTGGTGCGGCGTTTGACCTGGATATGTGGGAGAGGGTAGCAGAACAGAACGGAATTGTTGTATATAGGGAATGGCGTTTGATCTCGTTCGACAAGACAAAATCGCATTCGTAAGCGCAAGCATTTTCTTTTTTCTCGCTTAACTCGAATCAGCGGTCATTTCTCCAAGAGGGATCCTTGCGGCAGCCCATTGGAGAAATGTTGGCGAATCGGAGAAAAAACAAAATTTCAGATCCCCCGACCCATCCTCGCGCGCACCGCCGCTCAGTCTTATTTTTTTGTTGTCTTTTTTTTTTTTTTTAGTTGTTTAGTGATGGGGTGGCTGCGTGGGTGGGTGGGTTTATTTCTTTCGTATTAAAATCTTTTCTTCGTTTTTTTTTCTGTTTGGTGTGAAACTGGCCGTGGCTTGCGTTGTTGTGGTTTCGAACGAACGAAGCGAACGGAGGCTGCTGGCTCGGGCATATGGACGTGGGCGTGGTGGTGTCAGATGTGTTGTGGATTGTATGTGGTGTGGATGATGTTCATTGGATGTGTGTCTTGTTTTGTGTGTGCCTGTCAACTCT GCTGATCCTCAGGATGCTGTTCTTGTTACGTTTTTTTTTTTTTGTGCGGAACGTGCAGTTCCAGAAGAAAGTTTCGCCAAAGAGCTAAAGTTTAAGGTAGGTATCTAAGCCTACCTAGCAGATATTTATGCAGGTGAGCTGATTGGTGTGTTTGTGTGTGCGTGTTTCTTGTGTTGTGTGTGATCCAATTGCTTTCGTGTGATCGAGTGTGAAATGTCGCAGTTACACAGAGACGTTGGCAATCGACAAGCAGCAACAACGAACTTTTCTTAGCTTTTCTTTACTTTCTTGACTTTTCTTTGCTTTGCTTTGGACACCCTGTTCGACAGCAGAGAGAGCGTAGACAAAGTTGCACAGGCATTAGATATCGAATCGAAACGGGAGTAAAGGATTGGACGTGGACTTGGAGTGATGGAGTGGAGCGAGCACTGGATGAAGTGTTTGGATTGGTGGTGCATGTGAGCATGATTAAGACTTGGTGAAGCTGGGGATGTGTGATGCAGAGATCATGGTTGGGGGGAAATGGAGCGGTATGAGCGAG


Search Again