CR00728

CRIMIC CR00728

Gene CG5142

CG5142

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80363

Images

Construct Sequences

sgRNA sequence
AATCCCTCTCACAAAAGTACCGG

Amplicon 5' Amplicon 3'
GCGCAATCATCCAGAGCTTGGAATAGGCGCCCAGATGGATATTCCCGATGGCGGTGCCAGGAGCGTGGGCAATCCCATCACCATGGCCATTTCGGGCATAACTCAGGCACTTAATCTCAAGGCAGCCATTGAATTTCAAGATGGCAATGAGGAAGCAGCCAGGGACGCCCTCCTGGACCTTCCTCCACGAGCCGAAAGCGAACTAGATCCGGTCACATTGCACAACATGGCCTTAACCGATGTCGAAGGTCCTGTGGCGGGTCTGAGGAAGCTGGCGTTTCTCCTGGAACTGGGTGCACCCTCCTGCCCCAAGGAGACGTTCGCCAACATTCTGCTCATCTGCTGCAAGAACGAACTTTACGAAACTGCTGCGGATATCCTGGCGGAGCACACGGACCTCACCTACAAGTATCTTTCGCAATATCTCTATGAGTTATTGGACTCCCTAATAACCGCACAAACAAGTGCCGAGTTGGCCGAGAAGAAACTAGGTACTCTGGCCTCCAGTCTTGCTGGTAAACTGCGCAGCTTGGCCGCAAAAGTGCAGGAGGTCAGGGCCACCAATGAGCAACAGGCACTCAGGGATGCCCTCAAGGACTACGAACAGGCACTGGAACTGTGAGTTAACCTTAACGTGATATTTATTTTCTAGAATTTATTTACATTTCATTAAGTATGGGTCGCGTCTGGATTTGTGTTTATCAAATGCAACAGTATTTAATTTTATAATATTACGCTTTTTCAAACAAAGTTACTTGCCTGTGGTGATGGCTCGAGCCTGGATCTCTTGGCGGGATGATGACTTCGTCGGAGCTGAAAGGGAATTCCATGCCAGTGCCGAGTTCTGTTCGGAGAACTCCATTTGGCGATTGAATGCAGGACATGTGCTCTTCATGCAGGGCGACAAATACAACGAAGCGGCTGCGTTTTATGAACCCATCGTGCGCCAGCATTCGGATGATGTGAGATTGAAACATTTAAGCTATTCACACAGATATTTACTTTTTGAATGCCCGGTACTCAAAGTGAATAAGGGAGTTATACCAATAGCTAAGAGGTGTTTGAAATATGGCAATATCTTAGTAAGGGAAATATTTATAAAATCCATAAATCTTAGTAGAGAGCAGAATCCCTCTCACA GGTATCTAACAGTCGGTACAGCCGACTTTATCATATCAGGTGGCACCCAATTTTAATCTACCATCCCCCGTTTCAACCAGATCATGTCCGTTTCTGCAGCGGTGCTGGCCAACCTGTGCGTCTCCTACATCATGACATTCCAGAACGAGGAGGCCGAGGAGCTGATGCGTAAAGTGGAAAAGGCCGAGGAGATGAAGGGCAATCTGGGCAAGCAATACCACCACCTGTGCATTGTCAATCTGGTGGTGGGCACACTGTACTGCGCCAAATCCAACTATGAGTTCGGCCTATCCCGCATCGCCCATGCCCTGGAGAGTGGGTCTGGGAACCGGCTGTATGCCGACACCTGGCTGCATGTGAAGCACTGTATCCTGGGGCTTCTCACCGGCATGGCCAAGCAGAACATTATCCTGCCCTATGCCACCGTGCAGGAGGTCCTCAACTTTCTGCGCTTTTGCGAGTCCTACGGCCTCTTTACGCCGGCCAACATTTTTTCGGCCACCGAACAAGTGCCGGAGGAGCCACTTACCATTGGCCTGGAGGCCAGGAAGTTGAGGCTCCTATTGATTAAGCTGAGCGAATACGATAACTTTTAGATTCGGCTTTAACTGTTTAACAAATGTATAAGAAATAAACATCAAATAAAATTAAGAAGAAGTTTTGATATATGTCATATCCTTTAATTGCACTTTCCTGCACCTTCTTTAAAGAACTTAATTTAATTGTGATAAGACAAATATGAAATTTCAGAAAAAACCTTATCGATTAATTTGTCTTTGCTCTGTGACAGCTGGTAATGCCACAAAGGACTCTGGCCGAAGTG


Search Again