CR00725

CRIMIC CR00725

Gene jef

CG12858

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79289

Images

Construct Sequences

sgRNA sequence
AAGGATGTGCCAGTAAAGATAGG

Amplicon 5' Amplicon 3'
AGTGGGTCAACACGGTCATCCACTCTGGCAACTCCTTGGCCGTCTGGGCGAACACCTTGGACTCGGCACCAATATGCGGCTGTGGCTGATGGCCAGTGGCAAGGAAGCTACTGACGCCACCGGCACAGGCACCCGAGGCGGCACTGCCGCTACCAACTGCCAGCGATGGCAGATTTAGCTGGGCCGCCAACTGGTTCATCGACTCCTCCTCCGCCCGCTTATTGGGATCCACGAACTGCGCCTGCTGCTGTGCCGCCAACTGTTCATCGATGGGATCGTACTTGAAGGTGATCTTCGATGCGGAGATTATCGCACAGGTCATCAGCACCGAAAAGATGGAGAAGCAGATGTTGTAGTTCTTCTCCTTGTTGCCGGCACCACAGGGATGATTCGAGAACGAGGTGGAGTGATCCAGAGCGATGCCCACCAGGAACATAGAGATGCCCCAGCCGAGTGACCCAAACATTCGCTGGTGACCGTACTTGTCCGCATCCTCGCCCAGCAAAGTTATTACGGCGGAATCAGCCAAGGTAATCGCCGGAGCGCTGAAGAACTCCCCAATGAGGATCACCAGGAGCAGCAGGAAGAACGCCTTTTGGATGTCCTGTGGAAGGAGATAAATTTGTATAAGTACTTTTAAAAGCATTCCAGAGATACAATCCTCTTGGCAGCTGAGACGTTAAGTTAAAGAGGCGAGAACTTTTAGACATAAATTACTTAGTAGATCTTGAAATGGCAATAAAGATATGGATTGCAAAGCTAAAACTATATAAGTTAGGATTTCATATCCAACATTACATTATCAAGTTTGTATATCATAAATGGAACACAACCTAAATCGAATATATCAAATTTAACTATTTGGAAACGAACCTAATAAACATTACATTCTAATATATACAAATATAAAATTTATTTCATTCCTATCTTTTTGAAGATCTTATCTTCCTTCCTATCTTTACTGGCACATCCTTCCCTAT TTACTGGCACATCCTTCCCTATTCACTTACCGGAGTCCTGTACACCATGGAGCTAAAGATGGGCGTCACATAGTCCCTGTGGTACTTGTCGTCGTAGTTGCTCACAAAGTTGATGTGCACTGGTGAGATGCCCGCATCGATCCTTGGCAGCAGCAGTGATCTCTTGTGCCGACTGTGTGCTGCCTCCGCCTCCTCCAGCGCCTCATCGGCTGGCATGGTGCCAGTGCCCATATCCAAGTGCTCCTGCTCGTACATGGCCGACAGGTCGCGCTTCGTGCGTGTGTAGGTCAGCACAAAGTCCGTGGCATTGCGTCGCTCAATGCAATTGATGGCCTCCGGTCGGATGAAGCTCAGCGGAATGGTAAAGAGTACCCAACAGGCCAGGGAGCCCAGGAGCAGACGCTTGCCCTGCCGACAACGATCCGCATAGGAGCCCCAAAACGGGGCCGACAGGAACTCCACGAATGGCCGCATTCCCACCAGAATTCCGCACTGGCCCGGATTCATGCCCATCTGCTTGAAATACACGCCCATCAGCGGAAACAGTGATCCAAATGCAGCGTAGAAGAAAAAGTAGAAGCTTTTCACGGGTATCAGTTCCCGTTCTGTGCTCGCCCCGAAAAACATTTCCAGGATGTCCGAGTGGCCGCGAACTTTGTGCGTTGAGT


Search Again