CR00724

CRIMIC CR00724

Gene Atg7

CG5489

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79288

Images

Construct Sequences

sgRNA sequence
ATTCCGCTACCGCATGCCGTTGG

Amplicon 5' Amplicon 3'
CGTGTCACTGTGCACTGTTGATCCAAAGTTCGGTCTTTGAGCGACTGAAAATGGAATAGAACGAAATGCAATGAGTATCTGTATCCAAATTTGTACGTACAACTTTATAAAGCGAGTCTATAAGAGATTTTTTTATACAGAGTTTTTTTCAGTGTGATTTGGAGCACATTCGACGCCGGTGCAGTAGTACGATCAAGAGCTTTTGAAAGCTTTTCTGTGTCCACAAACACATGCTCCGAGCAAACAAAGATGACGCCTTCGGGCGAGAACAAAACAAATAGCAGCGCTTAAAAACCAAAAACACAAGATATAGAAAACTTCGGCGTTTGTATCGGTTACTTGAGCAACCCGCCGCTCCGCCCATCACTGATTAGATAAAGTTTTAACATTTGGGAGAGCCGGAGAACTCCGGACTCTCCCACGGAACTATAAAACACATTTTGCGCTTGATTGTTCAGTACAAAGGCGATAGTTAGTTGAATTGGTAATTGCAGGAAGGAATCATGTTGACCGAATTCGCTGGCAATCTATCGCATCCGCTGGAGTTTGGTCATGTTCTGGAGGTCGTGGCCAAGACCATCGATGGAGCAGCCAGGTAAGTGTTGTCCGGCATTAATGTAAGACCGCTTTTCCGTTTTCTGACTAATTACTTGTCAAATTGGGCTTCTTATCAGTACGTGACTAATCGATTGTGATCATTTGGTTCGGATAGGTTCCACATTAACCTCTGCACGGCCAAGAGCACGGTCGATCCGAACGCAGATATTGGGCTACGCTTCTCATGCTATTTTCGGAACGATGTGATCGTTCGAAATTCCCGGATAAACGGCGCCTGGGGCGAGGAGGAGTCCCATGTCATGGACCCCAACACCCTGCCCAATCCCATCGTCAGTGGCGAGTTCTTTTTGGTCTACATTCTTTGTTGCGAGGACAGCTTTGCCATCTCGATAAATAGCCGAGAGTTCTGCAGATTCCGCTACCG ATTCGTGCTCTGGAGATCCGTGATCAGATCCAAGTCATTAAACAGGTGGATCATCGTACTGTGTTTCCAAATCCGTGGCCAGCCGTTCACGCCTCGGACTACTTTAAGGCGTTCAGTAACGATCAGCCAATTTTGTTTAGTCCGGGCCATGTGATTGTCCTTACAGCTCGGTGTTTCGAGAATAAAAAGGGACAGTTCATAATCAAGTTCATGGACTCGGATACCAAGCGCGAAGAGCTACACTTCAGTGTGCGTTTCGATGAGAAGGCAGTAGTGCGCAATTCCATGAACAAAAATTTTGAGTAAGTTAACTTTATAATGCCGTACCTCTTTGGGCGTTAACTAATTCTTTTTATAGATTCGGAAGCGAGGAGCGTCATGGAGGTTTCCCCTTCGTCTTTAACCAGCAATTCAAGCTGGCGCTTGCGTTTACGGAACGCGAGGTTTTGACTGCAGTGGACGGTTATAACTTCTTCAGCTACACCTGGCGCACACCTAATGCCATGATGAATCTAGTGGGTTTCAAGGTGACCAGCATAAATGGCCTGGTAGTGCAGATAACTGGTGTGGATCACCTGCAGACGGGGGATCCTACGTGCGCTGGCTTCGAAAAATATTCCCGCCATGATTACGAATGCGTTTAGTAACCATGTTAACCCAACTAATGAAGTCTGAAAATACAAATGTTATCTTAAACTATACAACAAATGGGACTTACATTTCCAGGGGCCGTAACATCGTTACAAAAGTAGCAACCTAATTGATCGCCATTAATGCACTTAAGTCCTTCGATTTCTTGGCCATCGTCGCCTGCTTCCTTACGCGTAGTGCCATGTCGCATTACCAGATAACTGTCAAAGCCTAAAGCTGCGTTGATGACAATCTATAAGGGAAACATTTTAGGTACATCTCTTCTGAAAGGTGAGTATATGATTGTTCCCACTTTTTCCTTTGCCGCTCCAAGCAGGGTGGGCAGCCAGCGGCTTTCGCGCGAATCTGTGAG


Search Again