CR00723

CRIMIC CR00723

Gene grnd

CG10176

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79287

Images

Construct Sequences

sgRNA sequence
GAACCCGCCAAATTACCCTATGG

Amplicon 5' Amplicon 3'
TCAAGTCACGGTGCGAATGAGTGTGTATTTGAGATAGATGCCTCGGTGCGAGTGCTGAGTTGTTGGTAACAGCGAGCGATCGCGGCATTCCAGTCAGTAACGAGTTGAATGTGGCTCAAAACGCGTCGCTGAACGATGGCTAAAAACGTTTAAAGTTAAAAAGCGTATTAAATCATATAATATATAATATATTGGTGTAAAAAATACAGAATTAAACCTAATAATTAAGTGTCCGGACATCCCCTAGAAAAATGTGTGAAAATGTTGAGAAACTAACCGGAATACTATGAAAACTGCTGTAAAACTTGGCTAAGATAAACTCGTTTGCACCAATACACATGTGATTATACGTATAAGGGCAACGCAAAATACTCAGACTCCAGAAGCCAGCAATTAAAAAAGAAGTTAGTCAGTTAGCGTCTGGGCCGCGTTACTGGTGTATGAATCATACTTTGGATACGTTTAAAAATAACAAAACAAAAACCTTAAAACGAGGAAAAAGTTGTAACAGTGCTAATGTAAACTTCGATCAAACTTAGCGGAACGAGCTCGCTACAAAACCAAATACCCATAACAAGTAAATTAAGCACACATTATAAAATACCTCAAATGTCGGTCAGGAAGTTGAGTGCCCTATCGCTCTCCATTGGTGGAGTTCCGTTGATTCCAAGTGTTTCCTTGGTAGCTGCGGCCAATGGAGAGAGTAGGGATTGCCATGGCACGATCTGTCATCCGGTCAATGAATTTTGCTATGTTGCAACGGAGAGATGTCATCCGTGCATCGAGGTCTGCAATAATCAAACCCACAACTACGATGCGTTTCTGTGCGCCAAGGAATGTTCAGGCAAGTAGAATTCAAAGATTTCCAAAAGATTACCTCAGATTAACTCACGATCCATAGGGTAATTTGGCGGGTTCT TTGGCGGGTTCTATGCAAGTTCAGGTTTTTCCAGCTGGACTTAATTGTATTTCAATTACAGTTGCTTCAGCGGGTGATTAACTCATCACCCATGAGTTGACTAAAATAGGGGGTATTTTAAAGATTTAAAGAATGTACATTTTTATAATAAAAATGATTTGTTGAAACTAGCTTTATAATAATTTTTTTAGTGTAAAAGATTTGTAAAAGTTGTAATGGCAAGATAAGGCCAGTTGCATTTGCAATTTTTATCTGACTATGTACAACGAGTTATCAAAAACGTTCCCGTGTTTTATCAATTATTATTTACTTAAAACGATAATAGTAGCGATATTATTTAATTTCTTTATCAACCCACAGCTTACAAGACATTTGAGCCGTTAAAAGCCGAGATGCTGGACATCCAGAATACCCAGCAGCTGATCCTCTTGCTGCTGACTATCCTTCTCGTCCTGATTGCGCTTCGTTGCGCGTTTCAGTTCCTTCGATGGCTGATAGGCAATCGGTGCTTCCAGAAGCTGATGCGCCGTCTCCAATCGAAGGCCTACCCTCATCCGGCAACTGCAAATGGAAAGGATCTTAATGCTACCACCATACAGAATCTGAATGCCATTAACCATCCCGGCAGCGACCTTGAGCGGGCACAATCACAGATCTACAGTGTGGCAGGTAAGTGTAAGGATCTACCTGTCCGGGTTTTTCCAATAACACTTCCCAATGTACACATTATACCTGCAATGATTTATTACAGGTGCTGCCGAGGGTTCCGTTGTGACTATGACAACGCCGGTGAGCACTCGCTATCCGGCGGAAAACAGTACCACGCCCACAACGGTTATGACGGA


Search Again