CR00722

CRIMIC CR00722

Gene ref(2)P

CG10360

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGGTGAATCCCTGCTTTGTTGGG

Amplicon 5' Amplicon 3'
ACCCCAGTTCAGATTGACCGTTTTATTGCCTCCCATTTTTATAGTTCCGAAGAAAATTACGAACGCAGAGGCATCATTTTAGATTACCTAGATTGCCAAGTTTCATAAAACAAAACCATCTTTAGATTAGGTTTTCAATATTTCGGGTTTGCTGATTTCGATATCGATAAGAAACTGACGTATGTATGTGTGAAGTTTTAATGGGTAAAAATATCGATATTCTGGCGAAATTTTATGTAAAGCAAAATGTGAATGTAAAAATACTAAAAGTGGTGAGTTCGATAGAGCCGCGTAAAAATATTTTCATTATCGATAACCGAAGTATTATTAATCTTTGCCAAAGACCAGCTTTGGCATTACAATACAATTTTGGGGATAGATTAACTAGTGCAGCCCAGCAGGCAGCACCGTGATTTGCAACAATTTGAGCCTCACTCATTCAAGAACCTTCCAGCAACTAGTTCGCCTAGTATATATACCTGCTCTCACCCAGCTGCACTTGTATACACAATCGAACGGCCGAACAAAAACTACGCAGTAGTCGAGAGCTCCAAATTAATAGAATCCGTCACATAAATTCGCCGCAACAAGTTAAACGAGAATAAAAGCGTCAGCATCGATATATATACATACATATATTCAAAAGTCTGTCGAAACTACAGAATACGTTGCGAAAATGCCGGAGAAGCTGTTGAAAATCACCTACCAGGGCGCTGGACCCCAGAAAAAGATAAATGCATACCTGCGGATGCCCTCCCAGAATTACACCATATTGCGTCGCGAAATCGAGCTGTATCTTTTCCAGGAGCGCCAGTTACCCAAATGCGACGTAAGGACCTTCTGGATCGGTGAGTTTTACAATGAAAATGCCGCAGAGTGAATGTTTGCTATACATACAAACAGTTATTCGCAATTGCAATCGAGTCGCAAAGATTGCAACATATGTGCATGGTATAAGTACATTCGTTTCCATACATAACTGCATCCGTCCGAGCAGTGCTGACCATTTAGCTTTTAAGTCTCGTTACTTAAAAACCAGCCCAAATTATTGCGT AGCAGGGATTCACCTAGATAGTATTCCTGCTCAATGCTTATCATTGGCAAAATTGTGTTGACACATTAGCTGATAAATATGTACATATATATTTTTATGGTACAAACGTGGTCAACATATTAGATGCACTGTTTCATAAATGGCACACATACAAAACATTTTTGATTTTACATATTTCTGAATTCTCGAATTATACATATATATTTTAAATACATCTAACGCGCTTTTTAATTTGTAAAGTATGTGTACATGTACTCATATACATTTACATAGATCAAACGGGTTGTGCTGGTACAACCACAACTGTAGCTAATTTGTCTAACTAGAGCCCTCAGTGATTCACCTTTGATAACAAAACTTCACTGATTCATAATTGATTTTATTTTCCTTTGCCTATTCTAACTTTTGCAGACGCTGATAAAGATGAAATCGAAATAGTCAACCAAAATGACTATGAGATTTTCCTGGCCAAGTGCGAGAGCAATATGCACGTTCAGGTGGCTCCACTGGCGCCCGTAGAGGAGCCAAAGGCCACCAAGCAAGAGGGTTCTTCGGCCAACGCTGAAGCTCCTTCTGTCGACGATCCGAG


Search Again