CR00721

CRIMIC CR00721

Gene gcm2

CG3858

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79286

Images

Construct Sequences

sgRNA sequence
AAGCTCAACACTTACGCAGATGG

Amplicon 5' Amplicon 3'
CAAATTATGCGGGTGGCTCGTCGCTGTATCGTCGCTTTCCCCGCTTTCCCGCTCCTCCGCCCACTTTCGAATATTTTGTTGGTTTTTGTAGGTGGAGCCAGAGCCATAATACCATTCCTTTGTTGACAAAACTTGGCACTACTACTCGCTCGCTGAAGTTTGTTTTTGTCTGCTGCTGCCGCTGCTGCTCTTTTGTTTTTCGTATCTGCCAGATACGCGCGCACATCCCGCCCTGCAGGTTGTATTCGAGGTTCAGCGAAAAGGTCGTCATTCTCACGGTTGTTTCCCATCGTCGGCGTCGCGTGCGCAATTCAGTTCAATCCAATCCAATCCGTTCCGAGGAGCTTCAACTAGCGACGGCTATCCGCGAGATACAAGTGCCCAGTGGATACAAGTGTCGCCTAATTGGATTACAATGCTCAAGTGTTGCCTGTTCGCAGGGCTTTCGAATCGCGGAAAACTCATTTAGGAGCAGTTGAGGTTTTATTGGATATTTTTAATTATACCACCTAATACCTGGATTAAAGAAGCTGCTTCAATTGGAATATGGTTGTTATGTAAGTTCTAAATAGTCCCTTTTTCGGAGATTTTCAAATGTAAATTCGAAATTTTATTGCCAAAAAATACTTTTAATAGGACAATAATCATATACTTTGTTCTCGAACCTTTTATCAAATATAATGGTAATTATTGAAATATGCTTAAAATAGGTTTCACTAAGTTTCTAAATTATTCTGCTTGGAACCCAAAGGAATATGGATTAAAAATTAATTTGCTCACATTATTCAAGGCATAGAGCTACCGAAGAATTAAAAAGCTCTCAGTACAAATGTTTCAAATTATTGCTGATCTGAACTGTGCCGACACGCGTTAAACCCAAG GCGTAAGTGTTGAGCTTCCAAACACCTCAGATCAATCTCGGATGAAGAATGGGCCACAAATCAAACGATAAAGAGGCAGCGGGGGAGGTCAGGGAAAATGTAAATGATTTCAAACGCTTTATTATCACGCTGAGCGCGTTCCACAGCTTAGTTAATGGCACTCCGGTCCAGTCCAATCCGCTCCAAAGAGCCGCGGGGTGTGCCTCGTATTTTGGATGTTGGATTTCGGAAGGGGGATCTCGAATCTTGGAAACCGGCGGACCACACACAGTCGTAGGCGGAGCGGCGCTCGAGTGAAAGGGTCAAAGAGCCGATGATGATGATGATGCCCCCCCGGCCCCTTCGATTTATAGAGACATATTTTCTAGGTGACAAACTTATTATGAGCCCTGGACAGAGGAGGCCCAAAAATACAGATCTCGAACGAAGTGAGACGCTATCAGCATCAGATAAGCCCAACTAACGAGCGCCCCGAAGTGTCGAGCAGTCAATTTACGGACCCAAAACAAAGCGAGCCACTAGCCACGAACAGGTT


Search Again