CR00719

CRIMIC CR00719

Gene RpL18A

CG6510

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80630

Images

Construct Sequences

sgRNA sequence
ACAAACACACGCATGGCTGTTGG

Amplicon 5' Amplicon 3'
ATCGTGGAACTGCTTCACGTGCACGCGGCGGGTCTTGGCGGCAGGGATCGAGTCCACCTTAATGATCTGGATGGAGTGGGCACGGGCACGGTGGCGGGCTCCCATGTCGCGGTAGCACTGAGTGACGGCACCGCCGACAGTCAGGTCACGGTACTCGCGGTACATGTTGTGGGTGCCCGAGCGGGAATCGTAACGCAGCCAGATGCCGAAGTTCTTGATCTTCACGGGCGACGTCTCGTACACCTGCTTGATGGACACGATCTCGCCGGTGGTCTTCTTGAACTTCTTCAGTTGGCGCAGGAAGTACCAGAAGCGGGATTTGGCCACGATGTTGTCGGGGGCAAAGATGCGCATCTTGTAGAGGGGAGTCTGGGGCTCCTTCTCGCTGGGCAGCTTGCGGCCCACGACCTCGTACTCCTTCAACTGCAAATGGGATTTGGATTAGTTTAAATGGTCTACATAAAACAATTGTAAACAAATGCGAACAGTCGCAGGCAAACAAACACA GTTATGTTTTCGGCGGCACAAAGCAGTTGTATTTCTATTATATTGAATATGTTTGAATAGTTAGTTATAAATTCGTACTGAATAATAGTTTCTCACAATTATGTAAATTACTTTTGTGAGTTAGATAGGATCACATTTTTAAGAAAAGTGGCTCGGCAAACATTGTCCACGACAATGTCGTTTTTTACACAGAAATTACGGAGTTTTAAAAAATCCAACGATTACGCCAAATAGGCTATGTTTTTGCTTATCTGTTGCACGCATTTTAAACTAAAATAATGATTGTATAAATCATTTATTTTGGCAAATACTAACCAATCCCTTGGCTCTCATGTTGGACGTTCACGCGAAAAGGAAACGGAAAGAGCTTGTCAAATCGGTATGACACTGAACCTCGATTCAGGGATGGAAAAAACTATCGATAGCTAACTACGAATATTAGTTATGATTGATCCACTGTGATACTGGACGTGCTATAATGGTTCGTTTAAAATTAAGATAATTACTCAAGATAATATTTTTAAATAGCCCGTGTAAATAAGATTTTAACAATAATTGCTGGTACTGGCCAAGTATCGATATGCTTACATTGAACCGCAAGGGAAAAGCACAGCGATGCCTGTCACACGGTTGCATTTTTGGCAGTCACACCAACACGCTGCGCCAGCTATCGAACTA


Search Again