CR00718

CRIMIC CR00718

Gene Fem-1

CG9025

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79285

Images

Construct Sequences

sgRNA sequence
AACGTGAGGTATGAAATCTCTGG

Amplicon 5' Amplicon 3'
AATGCGTTCCCTTATGGCCAGCGACTCCATGTGGATGGAGTGGTGATTAAGTTTGATGGCATACAATTCGGGCAGATTTTCAGTCTCAAGCCAATTGTCATACGCGGGCACAGTGGGCTGAACTCTTTTGCGGATCACACCGCGTGGATTGCTGTAACGTAGCTGCATGGCTCTCAGCAGATAGCCATAGGCCTTATTCACGTCGTATTTGATTTTGTCATTCGCATAAGTGGCTCCCAGAAGCTCCAATGCTGTGATCTGCTCCTCCAAGCTCATCAGTTCTGGTCGTTCGATGAACGCTTCAAGGACATCCTCATGGAGACGTTCGGCAGCCTGCAAGGCGGGCGTAATTCCCAGCTCATTCTTCTTCAGAGTGGCGCCATGGTCAAGCAGGGCTACCACCACATCCAGGTGACCGCTTTCGGCCGCATAGTGCAAGGCAGTGGCGCCGCACAGCGCCTGATCATTGGCCCTTGATCCATTCTGAAGTAGAGTCTTTACCACCAGGTGGTGACCCTTGTAGGCGGCAATCATAAGCGTGTTGTTGTTGAACAAATTCGTGGCATTCACATCAGCGCCATTGTCAATTAGGAATTCAACGATGTCCAATCGACCTGTGGAAATATTCAAATTAATAACATATCCATGATTATGAGTGAAATATACGAAGTAAGCGTATAATTCATAGCACTTCCGTATAGTGAGAGCTTTTGGATGCTTACCCTCATAGCAGGCCGCTCTCAGCGGCGACGACTGCGCCTTGGTATTGTGATTGATGGCCGCTCCCGCTTGGACGAGCATTTTGACTATCTGCAGATGCCCCATTCCGGCAGCCACCCACAGGGCTGTGGCTCCGTAGACCACCATCCCGTCGTAGATGACATTGCATTCTCGGTCCAAGTCGACGTCGTAGTGCGACAGCAGAGTCTTCACGAATTTCACATTGCCCATCATCGCGGCCATGGTCAGGGGTGTTAGCGATTGTCCATCCGGCTGATCGAAATTCTGGCGATGAAAAATGTATAGAAACTAGAATGTTTGGAGGGGCCAGGGAAAACTTATGATGTGCGTGCGCAGCCGTTTCACAGTCAAGGTTGGACGAAAATAGTGCGTCGCAAGTGATAAACG CATGCGCGCTTTCTTTGTTCTTTGTGCTTTACATGGGCGAAATGGGACTTGGGCAAAGTCCATAAACTTGGCAACTGCGTTGCGGCACGGTTAGAGCAGCATCTGAATGTGGGTCAAGGAACTGCTGGCCCGGGACGGGACACTCACCGCCGGATACGTGATGTAGTTCGTCACGGGCAGCGTGTCGTTGGCTCCTCGCCAGAATCCTGCTCCAGGCCAAGCGGACTCATACCACCGCTTGCGAGTGCTGCAATTAATTTGTGAAAAGCCATTTGATTCGAGATCAATTCTAGCTGGAGCTTGGGCATAAAACCCAACTATGTATTACCGATACAGCTCCGCGTGCATGGCCTGCAATCTGAATTTTAACTGACAGCTGCCTTGACAGTGGAGTTCCGAGCACCGAAAAACTCGATAAAACTTCGCCAGGCTCACGATTCCATTCTCAACCCTAAGTTTGCATACGCTTCCAGTATTTTTGGGGGTTGAATCGCACGGAGAGGCAGCGATAGATCCTGCGCAGGGCCAAACAGCTGTTCAAGGAGAGAGGTCCTTGAGGGCTTGTTTACCGCCCGCAGCTGTTTGCCTGCCTGCATTCCAGCAATCCATTGCAGCTCGGAGAGAGTGGATACGATAGGATAGGACAATAAAATAGGGGGTGGAAGCAGAGT


Search Again