CR00717

CRIMIC CR00717

Gene CG10602

CG10602

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79284

Images

Construct Sequences

sgRNA sequence
GAGTACTTGGGGGAACGCACTGG

Amplicon 5' Amplicon 3'
GAAGCCCTCGTTCAACCAGAAATGCTCGAAGTTCTTGTTGGTCACAAGATTACCAGTCCAGCTGTGGGCTATCTCGTGAGCCACAACGTCGGCCAGAGACTTATCACCGGCCAAAAGAGTGGGAGTTACGAAGGTGAGGCATGGATTCTCCATGCCACCAAAGGGGAATGAGGGGGGCATCACCAGAAGATCGTACTGCTTCCAGACATACGGACCACACAACTCAGTGGCAGTCTTTAGCATGGTAGCTGTTTCGGAAAACTCCTCGGCGCAGGCATCCACGATGGCTTCCTCAGCCCAGACACTGGAGTTCTCCCCCAGCGGGCGGGAAACCAATTTGCCAATGGCAATGGCCACCAGATAAGCGGGAATGGGCACCTCCTGCTTGAATAGTGTCTTTCCCGGTTCCTTCTTATCGATAAGGGCGCTCATCAGGGCCGTGAGCTCGCTGGGATGCTCCACTGTGGCATCATAGGTAAACTTAACAGCTGGCGTGTCTTGGCAGGGAATCACCGAGCGAGCGTGGATTGCCTGGCATTGGGAGAACATATAAGGATGCTCCTTGCCCAAAGTCTGGGTGGGATTCAGCCACTGCAACCCACTGGCGCTGCTTGAAGTCTCGTAATCGATGCGAACGTTAAGGCTAGATAGGAGTGTTTTAGATTATTAATGACTTTCATAGATTAGATTATCTATCGCCGAGGTTTTACCTTCCCTTAGCCGTTCCAGATGGCAACTCCAGCGTTAGCTTCTGGCCAATATCATCGACGGCATCGCTGATAAAGAAGTTGATCGGGAGCTCACTGCCTCCGGCCAGCAGCGTGGCATTGGTTACATTGATGTCGCGGACATCAAGGAGCTAAGTTACATGTAAGGTAAATGGGTAAATAAGAAGTTCTAGGAACATGCCGCGGAATGAATATCTTCCAGAATTCTTATGCTGGATCCAGTGCGTTCCCCCAAGTACTCAC CGTTCCCCCAAGTACTCACAATTTTGTCCAGATTGGCAGTCAACACCTTGAAGCGATGGAGCACGCTTCCTTGGATTTTGGTTGCTGCAAAGTCGATCTTCCAGTTGAGAGCACTGTGCTCAGTGGTGATCAAATCGGGCTGCGAGTAAGAACTGGGATCCACGACTCCTAAGCGACCCATGTTGCGTTTTTGTACTTGGTAAATCGGGAGTAGTTTGTGTGAAGTGCACAAGCCGCGAGTAGAGACTGAAAAAGAGTAAGAAATATTTGAAAATTGTTAACTTTCTGCGATAGTGCTATCGTATGCCATAAAAATGTGCACAGATAAGCCAAAAGCTGTGGTTAAATTCTAACAGCTGCTGTTGTGTGGTTTAAGATATTTACGTTAAGTGATGACCGCACTTTCTATATAGTATATTTATTCACGTACGTTAAAATAATTCGTGGGCGGCGTCGATAGATATGGGTGCAAAATGAAGCAGATACAAATGAGATGAATAAGTTGCAATTCACTGCCACACAGCCGGTAAATTGCAGGGTTGTCGAGGATCGCAAAGTGTTAGACACAACAATCTATTAATTATGAAATAAATTAAGCAGCTTGCCAAACTAAATACGTTATTTCCAGTGCCAAGTTACTTTCTTTAAATTCTTGCTATTCTGACATAAATTGTAAAGTCTATAAAAATTAACCTGAAGCTTAGCTGCCTGGCATCCCTTTTGCAGTATTGCCAGCCCAAAAAAATCTCACGCTTTTAGATTAGTGAAGTCGCCGCCGTTATACCATGTAATAAACAATAAAATCACATAAAATTTGGCTATAGAAAATAAGAATTGAAAAAAAAAAATTAAAACTTCAATAAGCTTTTTCCATATTTTGTATTTATCTTAATTACAATGATTTCCTATCAGCATATCAACGCAAGATATAATCCTTGGGATAATCCATAATGTTGGGGAAGTTCTCCAGCGTTTCTTTGTCGATATGATCCAGACGCTGGGGAATAGAGCGCGGCGTGCGGATTTGATTCGTGACGTTTTGCAGGATTTCCTCGGGCACCTGATCGTCGGCGAACAAGTGCAGTCTTTGCATGGTGTGCCTGCGCTGCAGATTTCCGCGCATCGAGTTGTACACGGCCTTCTTCATCACCATCGTGGGATCCTTCTCG


Search Again