CR00713

CRIMIC CR00713

Gene Fak

CG10023

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79283

Images

Construct Sequences

sgRNA sequence
TTTGGGCCTATTGGACACGTTGG

Amplicon 5' Amplicon 3'
ACCTTGTGACAGCGCCATTATTGATTTGACCACCAGTGTGGTGGCGCAATAAACTTCGTCATCTGCGCGGTTAGGTGGTCGACTTGGAACTGCACTGCCCAGGTTTCGTGCATTTGAACCCATCTGTTCTTCTGCAGATGTCAAGCTGGACAAATGATCCGCCGATGAGTGGTTCGACTTCAGTGAAGAAAGATTGGCATTTGGTGTCATAGGTCGAGAACTGGAGTTCGAGCAGTCCGGCAAACTGGAAGGACCAGCTGACATGAAGTCAAGCTTAAACATTTGAGCCTGATGATCATTGAGCGATCCTTGAGGTATTGAGCAGGATCTCTGCCGCTGAAAATTGTATGATATGAAACCTACATTCTTAATAGTTTTTATTTGCTACTCACTAGCAATTCTTCTTGAATTAACCATTCGCTGTCGCTGTTGCTATCCTTTTGCTGTTGTCGTAGTTTTTCGCCCAAAACATTGTGAATGCCCTGGAAATAAAAAGGATTTGTTACTCGCGGCTCAAGGATTTCAAGATTTTAAGTTAACTAAAACTTAAATAAATCCAAGCTAACTTAAAAATGTTACTAAATATAAATAAATATATAATGCTCTTTAGCATAAAAGTAAAAAACGAAGGGAAATAAAAAGGATATGCTAAGCTTGGCTGCCA TGTCCAATAGGCCCAAACCTGATTTCCCATTGCTTCAGCTTGCAATGTGGCCAAGCAAGCAGCTCCTTCGGAAATGGAAATGTTTGGGTTAACTGTGATGCTCTGTGGTCCCGAAGTCATCCACTGTCGCTCCATTTCTCTCTGATGTCTTAGACTTTCGTCCAAGTTGTGTGGGGATATAACTCCAAAGGAGTCCATTGGAATATTCTGCTGTAATCCCATGCAATCTGTGTTTTGTACTTGGCCCAGTTCAGCTGGGCGCACATTAACCATTGGGCTAAACTTGGGTTGCTGCCTAGCGGACACACAGGTCTTGAGTCCGATGCCCCCAAAATCGTAAATCTCCTCGGGTAGAGCTTCGCATTCAATAGAGGTTTTCATCTGTTGGCGATAGGCATGGAAGTATGTGTTCCGCTCCATGCTCCTCGATCGCTCTGCGGTATTCGTGCAGTTTGGTGGCGGCTTTGTATTGTAGAAAACAAGATTTTGTGCTGACATCAATGACTGGTGGCGTTCCAGGCTGCCACCTTTGGAGTGCATGGCTTTTGCTGGTGGTGGTTGGTGCCTCTCCAAGCTCCCATATAGGCTATATCCGGACACCTTGGACACAGACGGGTTAGAAATGTTTTCGGCTTGCATGTGTTCCTCTGTTTGGGGTGGGCAAACGACGAAGCTGCTCTTTGAAGGCAAACTACCCGTAAACATTCCTGCCTGGTGTGAATTGAGGGATTCATGGGGGTTAACTGAAGCAGTAAGGGGGTTAGCCAGTTGACTAGCGCTGCTATTAGCTGAAAATTGGGACCTAAGCCTTTCGGATTCTGCGATGGGGTCAAGTTTTAACAAATCTGCTGCTGGTAGCTTAGTAGTCTTAAGCGAAACATTCGGATTGCTGTCATCTAATCCTACGGCTAGAGTATTAAATACCGAAGCTGGTGTGGTGTACGCCGCTGGATTTATGCCTCGTTTTTGGTTCTCCATCATCAGTTTGGCCAGCACCGCGGGATTTTGTGCAATAATATAGGTCTGAGGTAGCCCCGTTGTTTCAGGCATTAAGCCAGTGATGTCTGCAAATAATTAAAACATTAGAATACTTATATAAATATTTACTTAAATAGAATTAATTACCAGGATCGTGCATCACCCTTGAAGGTTTCGATGGCGGA


Search Again