CR00712

CRIMIC CR00712

Gene esc

CG14941

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79282

Images

Construct Sequences

sgRNA sequence
ATCGTTACAGGCTTTCAGCATGG

Amplicon 5' Amplicon 3'
TAGTTGTCCCGGTTTCCAGCAGACAATGGCATTTTCGCAGGACTTGGAGAGCACAAAGTTGCCGAACCACTGCACACAGTCCACATAGTTCCTGTGTATATCCCGCGTTGAAAAATCGGGGAAGTGCTTGGTCACCGTGGGGAAAGGCAGCGTTGACTTCTCCTGGCTGAAAGTGTTCGACAGTTCGATCTTGTGATGGAACTCGGGCGTATTCAGACACCACAGCTTCAGCGAGTGATCCATGCCGCTCGACACAATGCGATCTCCACGCATATTAAAGTCGATGGACAGCACCTCATCGCGATGTCCCTCCACTCCGCCCAGGATGGCAATGCACACATGGCTCTGGATGTTCCACAATCTTATCGCGTGATCCTTGCTGCCCGAAAGCAAAAGCTGTAGCTTGTGCGGATGGAACTTCAGCTCGTTAATGGCCTGTCCATGGCCAATGTAGTTGCCCACCGCCTCATTCTGCTCGACATCAATAACCCGGATGACTCCGCGGTATCCAGCAGCGGCCAGGAGAGGTGAAGAGGTCTTAAGGTCGTACGACCAGGCGCAGGTGTAAAATACTTCATCGGGCTGGGAAGGGAATTCAAGATTTGTTGATGTATTTCGAGTTTGTACAATTACATTTGCGACCATATTCTCAGTTACTCTCGGCTAAATTAACAATATAAGCTTTAATTTGAAAACTTGACTGTTATGAAAAACCAAACTTAATACAAGAAATGATAAATGTTTGGATATTGTGAAACCATGCTGAAAGC GCCTGTAACGATTGTTCTTACTTTAAAACAATTAACAAAAGCAATGATTTAATAGAAACTTTGACTGGATCCCACTTTTTCTACAGCTTTGAATGCGATGTCTAATGTATGAAGCCCCTAACTTTAGCCAACTGATCAATAGGGTCTTGAAAGTGTATTCTGTATCCTGGCGACTCACATCCGGATCTGCATAGCAGTGGAGCAGCTGCATCCCGCCCTGTCGAGGGCACTCGTAGACGGTCACCCGGTTGCTGCCCGCCGTAGCGAAGACCTGTGGCTCATCCTTGCCCAGCAGCGTGTTGAAGGCTACGCCGAAGATGTTGGCTCCGTGGTTCTCCTTCACGTGGGTGCTTCATGGTAATCATTTGTAGGTTCAGTATCAGTGGCCAGCTGAGAAAGTGCATATTCTTACTCGTATTTGTAGGCGGCGCGACTTTTTGGCTTCGATTTGGTGCTCCGGCGACCGCGGCGCTTGCTGCGCGTGCTGGATGACGGGGACTTGCTGCGCGAGGTGGTGCTGTTGGTGGTATAGCTGGCCGACTCATCCTGCAGCCGGCACATGGCCCAAAAGATCCATTAATTCTCGGTTCGCACAGCCATTTGTCATTCGCTACTCACGCCGCATGATTCCTCCGACTCCTCGGGCTCGTTGCCGTTTTTCACTTTATCACTGCTCATTTCGAACGCGCGGCACGTTTGTACGGTTAAATGAAACCCAAATTAGGCCGCGACTTCAATGAACTATTCGATAATGCTTTTTTTAAATGTTTAAATAACGAGGCGAATGAAAATGTTTTTTTTTGGCGGCAATGGTGTGACCCCAGTCA


Search Again