CR00711

CRIMIC CR00711

Gene slim

CG5186

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79281

Images

Construct Sequences

sgRNA sequence
GGAGGTGCCTTCCGAGTGAGAGG

Amplicon 5' Amplicon 3'
AGCAATCTCAAATGGCCGGACAGATTCCCATGTACGCCTTCCAGCCGTTGCGTCTCGTCAAGTGCCAGTACAGGGATAAACATATACCCGGTGGATTCCCTCTGGCACGCAGTGGCCACCGGATCATTGCCTCCAATTCGCATCTGTATTCCCTGGGTGGCTACAATCCGCGGAGCGCCATGTCTGCATCACGCCACGGCCGATGTCTTCTCTTCCAGGAGCTGTGGAGCTACAACTTTGCCACGAGAACCTGGAGGCTGGAGCTGAATGCGGGCAATGCCGCCAATATGCCCGTGGAGCTGGCCTCCAATGCATTGACCATTCACAATAACGTGTTGATTGTGAGTATCTATTTGATGCTAATCGCTGCAGATGGGGGACGGGGTTCGTGGGGTTTTAGGCAGACGAAAATAGATGAGTTGGATTGTCTCTTGCTCGTTGGGTGTGTTGGTAAACACAAAGAAAAACCAACTCGATTGAAAATTGTGATCTTCAAAGAGAAGCAGAAAAGGTCTGTAGTTGTAGATTTCTTTGTTTTATTTCGTTCAAATTGCTAGTACTTGAAGTGATCATATTTCTTTCTGTGTAGGTTAGGCAAACTATCAATTGCAATAAAAAAAACTTGTTTGTGCTCAAGTAGAAAACACAATTGAATGGTGAAATGAGCAGAGAAATCAGGCACAGCTGATCGCGGAGATCTCGAAAGAGAGCAGTGAATAGTAGAGTAGTGAGAGAGGGCTATTCTGGGCAATGAAAATCGCCAGGGCCAATGCCACGCCCTGTTCCGCGTCTCAACACCGCCGCCTTTGCTTTTTGTTTATGCATTCTAAACACCCGAAATGTCAACCCAAACAGCTGCCCATGGCCATTGCCGTTTGCCTCTCACTCGGAAGGCACCTC GCACCTCCTTCACCTCCACCATCTCCTCCTCTGCCTCTGCGCATGCCAGGCAACCCTCTTTTTCCATTTTGGTTACTACGCAGTTGTTGTTTATGCTGCTGCCACATGCAACAACTTGTTTTCCAGCTTTCCCCACCTCGCGCTCGGCTGGAAAAACTGAAAACATTGTATTTACCATTTTTACCCACCCAGCAGCTGAGTGCGCGCGCTTTTTTAGTTTTCGGGAGGAAACCGAACCGAAAGCAAAGTCAAACGGGAGCTGTTGGCATTTCATGCTGGCATCAATGCCCTTCCCTTGCATTCCACAATTAGCTATAATTTGATGACGAATCATGCCCCGATACATACACAAAAACACACTGGAGACACATGTTTCCGCTTATCGGGGCTGCAGCTCAGCCTCCACCCCCCTCCCACAATACTGCTGGTCCCTCCCCATTTTCCCATTTCTCTGCTCTTTCACCACCAGGCGATGATAAGCTGCTGCAGCTCAAGTATCTGCTAATTAAATGCATTGGCAGCAATGTCAGGGACGTGGGTGCCACCCGCTTAACTCTACATACATACATATAACTATATATTGAAAAAATCCAGAGGTTTAGAAAGCTAAATTGTTTAATAAACAACGAGTTTTTTACTTCTTAGAAGAGTCATAACGATTTAAATGTAAAGTCTAGGAAAGTGGGCTTGTATACATTTTGTTTACTCTTTATTATTATTTTCTATATATCTTAGTGTCAGCTTTTCTTGAAAAGAAATTAAATTCTAATTTTAATACTACTCTTTCAGTCTCATGGCGGCACTGGTTATCCATTTGGAGTATCCTGCTCCAACGACTGTTACGTTTACCGAACGGCCAGCGCTGGCGCGACACCGGGCGTGGATCGCCTCCAGGTTAAGGGTGACCTGCCCACGGCTCAGTACGGACCGGGAATAGTGATCCACAAGCACTTCCTCTACACAATCGGCGGAACGACGGGATTTGATTACACTTGTGATGTTTATCGTTTGGATTTGCGCACCGGTATA


Search Again