CR00708

CRIMIC CR00708

Gene Sec24CD

CG10882

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80629

Images

Construct Sequences

sgRNA sequence
ATGGCAGCTTTGACGAGAATCGG

Amplicon 5' Amplicon 3'
GGCGGCTGAGAAGTAGATCCAGCTGCTGGAATCGGAGGCTGACCAGGTGCTGCTCCCGGCGTTGCCGCTTTCGGTGGCGGCATGTGCGGCAATCCCGCCAAAGTGGCGCTGTTCAAGCTCATCTGATTAATCCCACTGGCCACGCTTTGTGGAGTACTGCTGGGCGGTAGGGCTCCGTTGACATAACTTCCAGCTTGCGTCGGTGGTGGAGCACCGAATGCAGCATTGTTGTTGTTGGTCGGAGGAGGTGCTGCATTAGAGTTAAACTGATTGAAACCGGTTGGCGGTGGTGCCGCAGCAGCGGGAGCTCCTTGGGGGAGTGGTGGCTTCAGGGGATTGGCCCCACCGACACCGCCACCCACACTCAAACCTCCCATCGACGTGGCCAACTGCAAGAGAGAATGTTTTTTTTTTTTTTTTATTAATTTCACTTCATTTTTCTTATCTACAAGCTCAGCTTCACTCTTCTATTATGAAATCACGGATGACCTCTTTTACTGAATGAAGTGCTCGCAGCCGAAATTTCTAAACTTAAAAATACTGTCTTGGTTTAGGTATTCCTGTGCGTCATTGAGATACTTCCCATTGAATATCTGTATATCAAGGTGGCCAATTGGTTCAAAAGAGTAACGTAATTCTGCAATGCTTTTCAGATTCTAACCCTATTCTTATTATCGACTAGCTCAATAGGCTATTGCCAGAATGAAGCTGAAGGGAATACACATATATTTGACGTGTGCAACCGGATTGTCTTCCGATTCTCGTCAAAGCTGCCATGGTT TCGTCAAAGCTGCCATGGTTAAGGCTATCTATTCACCTGCTGCTGGTAGTTGCCATTGAGGTAAGGCTGGGATGCCGCCGACGTTGGTGGTGGTGCTCCGTACTGTGGTTGTTGTTGCTGCTGCTGCGGAGGCAGTTGTTGCTGCGGCGGCTGCTGCTGCGGTAGTTGTTGTTGCTGCGGTGGCCAACCTCCGGAATTCGGAGGAGGAGCCCCAAACTGGGGTTGCTGCTGGAACTGCGTGGGCGGTGGCCCGTACATATTCGGATTCATTTCTGGCCCGGATTAATCACCTGGGTTTTAGCGGAGAGGGTCGACGCTAAGCCAACAAACAACTTTCACGGAAAACGAAGAGAAAACACACACGGATTGGCTCAAAGTTCGCCACGGCGATTTAGCAATTTCGGGGGCTGCTCGGCCTGATTCCTGACCACTGACTCCTCGATTTTGGCCACTCGGTGTTGGCCTCAACTCTCGACGGCCGCGGCGGACGATCGCTGGTTGAAAAACAAGAATAATTTCGAGCTAAACGAACTTCCACGTCAGTTCCCTAATTCGATCTTTTTTGCTCTTTTTGCCTTGCCACGTAAGC


Search Again