CR00707

CRIMIC CR00707

Gene Cnot4

CG31716

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79280

Images

Construct Sequences

sgRNA sequence
CAACTCGGGTATTGGCCCATTGG

Amplicon 5' Amplicon 3'
TGAGGTGGACGATCTGACCTTCTTTCCGTGTACCTGCGGATATCAGGTACATACTGTCATTAAAGCACCCTTATCAGCAGCGTATTCAAGTGCTATTGCTTCCAGATTTGCCGATTCTGTTGGCATAGGATCCGCACGGATGAGAACAAGCTGTGTCCGGCATGCCGAAAGGAGTATCCCGAGAATCCAGCTGACTTCAAGCCGCTGTCGCAGGAGGAAGTATGTCGTGGTCACCTCGTATTCATTCCACTAACTTCTACTCTTCTTTAGATGATTGCCTTCAAGTCCCAGAAACGCCAAAGGGACCAACAACGAAAACAAAAGATCACCGAGAACCGCAAACACTTGGCCAACGTTCGCGTTGTCCAAAAGAACTTGGTGTTCGTTGTGGGGCTACCGCCACGACTTGCTGATGCAGACGTATGTTGATTTTGCGCCATAGATAACCGACAGCAAACCCACTCACAATTGCCATTTCAGATATTAAAGAAACACGAGTATTTCGGTAAATATGGGAAAATTCATAAAGTCGTTATAAATCCAAGTACCACGTATGCCGGGGTCCAGGTAAGAGTTGTAAGATTCAATTATTTATTACCTCTATACATTCATATGGCCCAATGGGCCAATACCCGAGTTGCTT GGCCAATACCCGAGTTGCTTAGTCATTTTTAGGTGGTTTCTATGAAAACTTTGATAATGGCACGTTTTCAATGAAACTGAACAGATTTACGTGTATCTACCAAAATTTATTTTCGATTAAAATGAATTTGAACCTTTTGTTGTTAGCTGCTCTGGTAAGCGAACATTGTTTATAACAAGAAGTTTAAGTTTATTTTTTAACCTTTTTTATTAATATATATATGTATTTTTTTATTTTAGGCAAAATTGTGTGCGAAATGCAAAAATTTCTTGTTAATTTATGATTAAATGGATCGGAATTTACGTTCTGTTTCCGTGCTTATGCTAAAAAAATCAACTTTTGACCAATTATGATAAGAGTCTATTTTAGAATAACCCCGATTATTGTATACAAATCAAAAAGCGTAACATTTGATAAACCTGCTTTCTATAAAACTGCGAGGGTATCAGAGTTTTCGGTCCACCGAATCGCGTTTCACACTCTGCCATCATTGCTTATTTAAATTTTTTCGATTTTAAAGGGTCCATCTGCTTCTGCGTATGTCACATATGTTAATAACTCGGATGCCTTGCGGGCCATTCAAAGCGTCAATAATATTATGATAGACGGTCGGCTTATAAAGACCAGCTTGGGGACAACCAAATACTGTAGCCACTTCATGAAGAACCAGCAGTGTCCCAAGGGCGACTGCATGTACTTACATGAATTGGGCGATCCCGAGGCCAGTTTCACAAAGGAGGTAAGTTGTGAGATAACTAAATTTGTCCGTATTTAAATGTTATGTCCGGATATTTAAAGGAAATGCATCAGGGAAAGCACCTGGAGTACGAGAAGCGCCTGCACGATACTCTAATTGCGTCATTGGGACCGAATGCAACAGGTA


Search Again