CR00706

CRIMIC CR00706

Gene CG4972

CG4972

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78995

Images

Construct Sequences

sgRNA sequence
CACTTGAACCACTTAGATAAAGG

Amplicon 5' Amplicon 3'
GTGCGCTGACCCACATTTTTATGTGCACTGACGAGGGCTTTATTTAATTAGCACTTTTGTATCTCATTAAAACACAATTTTCACTAATTATTATTCTTATCCGATGTATTTTGGAATATACTTAACTAACCATGTGAAAAATGATTATCTTCAATTTTTTAGGAAGCCGCGTAGCTTCAATATCCCTAGAAGCGAGGTCTTTGTACTCGTGGAATACTTCAAGACACTGTGTGCTCACACGGTAAGTGTAAACTCTTCACTACTGTTGCTCGAAATGTTTTTAACATTGTAATTTGCATCAAACAGGTTAACCGACTTGTCAATCCATGATTTTGATAAGTTACGGCAAGGTGCAGGAGGCCTTATTCTCATGTTGCCGGCGAATATCTTGAATCTGGATCCAGAAACCAAAGAACTTATAACTATTTTGGAGCAATCAATGCTGACCCACACAGCTGCTGTTCCCATTTACTTCGCTCCGTACAACAAAGATTTGGAAAAGATCATCGATGATATTACGTACACGACTACGGACAGTCCGGGTCAAAATCAAACAGCGTTGGCACAATTGGTTGTAACCGTCTCGGCCAACAGATATCACATTAATGTCGGCGGCGGCAGCATTGCGGCCAATAAGAATAGCAAAATTCCCATTATCCACGGCGAACTGATACCCAATCAATTGGCCCTAAAACCCACGGAATCTGTTGCAGATGGACAAAAACTCCCCGTCATCTTGATAACCGCGAATCTGAAAACCTTTGGTATATATAATGTAAGTAATCTGGTGACTGAGTAGATGAATAATTTAGTCTCTGATTTTGCAACCTAAAACTAAAATAACACCATAATTCTGCTTACAAGATAAGGGCTTCTTATCTGAAAGATTGTGGCCTTTATCTAAGTGGT AGTGGATTTATGATTCTCGGCAATGATTTGAAAGGTCAAAAGAGCTTATCTGAAGTAGATTCACTTATAATCATAATTATTTTGTCTTAAATTCAAGGATTATCCGGTGAATGCTGATGCTGCAGTTTTGCTGGTGCTGATGGAGTTGTTTAGTAAATTACACTATACATCCAGTATGGCACCGAAGTATCGACTCAGATTTTTGCTTTCGGACGCAGGCGTCCTACTAAACTTCCAAGGCTCCAAGAAGTGGCTCGAGGTTGATGATAATGCGCTGCAGGTAAAAAAATGTCTTCTAAAGGTTATATATATCAGTTTTTATCTAAAATCTTTATCTCTATTAGAACGTTGAGTTTGTGCTCTGCTTGGACACCATTAGCGAGAGCTTATCCTACACAACGGAAAATGCTTTGTACATGCATGTTTCCAAGCCACCCAAGGATAAGACTTCTATTAGCAACTTCTTCAAACTCTTGAAGTCATCAGCTGAAAAGTATTCCAATGGTCTGGCGGTCGAGGGTGTGCATAAGAAGATCAATCTAGCAGACACCAAACTGGCCTGGGAGCACGAGCGGTTCAGCATAAAGCGCTATCCCTCGTTCACTCTATCGTCTGTAAAGAGTCCAAGAAGCCCCATTCGTACAACCATTTTCAAAAACGACGAGAGTCGTCTAGTGGAGCACACTCTTAACACGACGCGAATTATTGCG


Search Again