CR00705

CRIMIC CR00705

Gene CG5022

CG5022

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78994

Images

Construct Sequences

sgRNA sequence
TTCGGCTGTAAACAGATGGGTGG

Amplicon 5' Amplicon 3'
CTCCCTTCCCACATCGCTTTTCACGTTTATATTTAATTTATGCAGACTTTTCCAGTATATGGCACCCATGGGCTACGATATACCAACAGTCACATCTGAACAAACACATGTTCGCGAGGCAGTTGTCCTTATTTGGTGCTTTATACCGTTAGTAGCCTCCCCACGCGAAAAACACCCCTAACGTGAACCACTAAAGGACGGCAAAGGACACGGCCAAAGCCGAAATATTTGGATATCTAAAATAACGAATAGAATGCCAAGCATTCGGAATTTGGCTCTAAAATAAGCTGGCGCAATCAAAAATCGCCCAATTCATTTAGTGACTTTTGTTTCGAGTGAAAGTTGCCGTGAAAGTGTCGCAGTCAACACAATCCAATCCACAAAATGTTCAGGAGCAAAAATGAGGGGAACATTGTGTACAAATGCACTGTGCGACTCCTCGATGACTCCGATGTCCTAGAGTGTGAATTTCAGGTTTGTGCTGCTCTTGAACTCTGTCAATGTTAACCTAATTGGACCGGTCATTGGATGAATCAGTTGCTGAACTCGAAAATCACTGCTCATCTGCAATCGATGGAGTATTTCTTTCTATCCGAATTTGTGCTAAAATTAAAGATACTGCTATTTTAGATAACCCAGTGCACAAATATAATGTTAAATTTAATGGGATTCCGTTGTTTTTATTTTTCCGTCCATTCGCGAGTGTCTCAAGTAAATACATAAAAACATACTAACTTATTAATATATTTTGGTACCTTGCGTTCGG CTAACGCCCTTTCTGCTTGCCGGCAAAAATATTGATGTAGTAATCCCCAAAAAGCATGCTATTAAAGCTGAAAATGAAATCTTCGAAATTTGTGGTCAATTCGCATACTTCTAAGTATTTGTACTTATAGTAATTTATTAAGCTTTGAAATTACTTTTAGCCAACTGGTACACTTTGTGGTTGTTTCTATGTAGTTCTAACCCCCATTTCACTTCCTTGAGGGTGTAAACAAGTCATACAAATTACCATTTTTTGGGAGGTGAGAGTATTTGGAAAGTGAAAATAAGTAGGAAAGACTAATGACTAGGACATATTTAACCTCTAAAGTATGCAATCATTTTCAGGAGTTTAAATATATCATATATATAAAACGTATAATAAACAAAATATAATATCAAAATATCCCATATTTTACAGCCCTTCCATAAGGGAATATACCTATTGGAGTACTTGTGCGGTGAGTTGGAGATCAAGGAGAAGGATTACTTCGGTTTGCGATATGTTGACTCCTCCAAACAGAGGGTAGGTATAACTATATATAATATAAATATTTGTCTAATTAACATAAACGTTTGTGAATAAATTATAAACAGCACTGGCTCGACCTGTCCAAATCAATTATTAAGCAATGCAAAGGTGAGCAATGTTTAAAAACGTATTAGCTTTATAAACTACAACTTTTATCTTGTCTTCAGAAATGGATCCACTATTGTTTTCGCTGAGAGTAAAGTTCTACCCTGCGGATCCATTTCGACTGACCGGAAATGCACGGATTATGCTCTATCAGCAGTTAAAGAGGGACCTTCGACATGGTCGCTTGTACTGCTCCTTGGGCGAGGCGGCTGCACTGGGCGCTCTAATAGTTCAAGGTCGGGATGAACACCTCTTAAATGAATTAACTTGCTAACTATATATATACTATTTCCTGTGCAGAGGAGCTGGGCGACTATAACGAAGACGTGCATGTGGGCAGTTACGTATCTTCCATAGAATTAGCACTGCGGCAGACGGAGTGTCTGGAGAAGAAGATAATCGAGCTGCATAAGAAGCGAGAGCCCGGACAGAATCTCT


Search Again