CR00704

CRIMIC CR00704

Gene CG44243

CG44243

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78993

Images

Construct Sequences

sgRNA sequence
CAAGGGCATACTCGTTGAGTGGG

Amplicon 5' Amplicon 3'
GCAAGTGCATTGTGTCCCAGATCACCTGGCAACAGAAATCACACACACCCGTACGCCCCACTTCCTTGTGTAAGCCATGAGCATGCTGTTGCGACGCAATTCCAGCCAGCTGCGGCTACTTCTCTCCTCCGCCGCTCAGGCCACGCGCCTGGCATCCAGCGGAGTGGAGCCACCATCTGCTGGACAGCAGGAGATTAAAAAGCAGAGGCGCCAGCCACCGCCCGTGGTTCCCGATTCGGAGATCAAGAAGTCCGTGTTCATCTCGCAGTCCAGCGATGTGTTCACCAACCTCGCTCTAGAGGATTGGCTGTACAAAAACTTTGATTTCAGCCGCCACCATGTGCTGCTGCTGTGGGCCAACGACCCGTGCGTAGTCATTGGTCGCCACCAGAATCCCTTCACCGAGGCTAATGTTTCGCAGCTGGTGGAACGCGGCATAACACTTGCACGCCGCAATAGTGGCGGTGGAGCGGTGTACCATGATCTTGGGAACCTCAACTGCACCTTTTTCTCGCCCAGAGAGCGCTACGATCGCAAGTACAACCTGAACATCGTGACCAGGGCCTTGTTCCGCGAATGGGCCATCAAGGCAGAGATAAATGAGCGCGACGACATTGTAGTGATGAATAAGAAGGTGAGGAGGAGCGGTGGCTCTTATCAAGGAATGATGCGACCCCGGCTGATCCCTCACATTGGCATCAGCTCACTTAACCAACAGCTGGGGCTGTGCATCTGGTCTTTATTTGCCCACTCAACGAGTATGCCC ACGAGTATGCCCTTGTTCAATTACAGATTTCCGGCACTGCGGCCAAGCTGGGACACCCGAACTCGTACCATCACTGCACCATTTTGGCCAGCGCCAACAAATTGCACTTGGGCGAATCTCTGGTGCGGGAGCCGGCCAATTATATTAGCAAGGCCACGGCTTCGGTGCCGTCGCCCATTCGCAACCTGGTTGATGTCAATCGCACGGTGAACGTTGCTCAGCTGCGTTCCGCCGTGGGTTACGAGTATTTGAGAACGGCTGCAACTACGCTTGAAGACGGCGGCAGCACACAGACGATGCAGCAGCGCGGCTTTCAGCTGGTCAATCCCACAGAGAAATGGTTCCCCGGCATTGAGGAATTGCGCTCCAACTACAGCTCTTGGGACTGGGTCATCGGCAAGACTCCCAAGTTCACCGTGCAGAAGGAACTGGAGGTGAAGGGCGATGAGCAGGACATGAAACTGAAACTAAGCGTGGAAGTGGAAGCGGTAAGATTTGTTTTGCCCTGTTTTAGAGAATTATCACTTATGATTTTACTAAATTTGTAGGGATTAATGAAGGAGATCGGCATCCAGCTGCCGCAGAGCGATCAGCTCGTCCCGGTGGTGACTCCGCTCCAGGGCAAGCCCTACAACGAGGAGAACCTGAACGGAATACTTGGCGCCCTTAAGCTCGTCAGCGCATCGAATGTGAAGCAGG


Search Again