CR00702

CRIMIC CR00702

Gene cta

CG17678

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no rxn no rxn80628

Images

Construct Sequences

sgRNA sequence
TACATATGGAACCACGGTTCGGG

Amplicon 5' Amplicon 3'
TGCCTAAACAGAAGCTGGCTTCGGAAAAATCAAATTTGTGAAATTTTAATGCTGAAATCGTTTGCCCACCAATTTTTTTTGCCCACGTCCAGTTTTCGAATTTGAAATTTCGATAAGGTTTAAAAATGTTCGAAAATCAAAAAGTTGACTTTTTCACAATCACAATAACATCGTTTGCCCACCATTTAGAATTTTGAAAAAAGCTGTACTTTAGAAAATACATATAAAGGCAATATCGGTATACTCAGAGAATACGTTTGCCAAACTCATAAATTAAATATCAGCATTAAAAAACGTTTGCCAAACCATAAAAAAAATGTAGGCGATCATCTGCAAGACAATATATGCATAACTGTATTGTGAATAATTAATAATAATAACAACATAAAAATATAATAATTAAATACAAAGATGGAAATATGTACCTATGTATGGAAATATGCTTCTATACCTTTCGTCGTTTGCTTTTCTGCTTACTCTTACTTTCGCAGAGTACGAAAATGTACATACATACAAAATGGGCACTTTAGTTCCAGCAGCAACTCACTCAAAGGATACTTTTCCATATACACCTGTGTTCAATGAAATAGCAGCGCAAGAGAAACTAATAAATACACAGGTATTTTCCCATGTCCTTTTCCGGAATCGACTTTTTATTCCACTTATTTTTGTAAAATGGAATGTGTAGATAGAAAAAAAAAGAAAATCCCGTTTGTTTTTCATGTTTTACTTATTTTCTTTACATTCTTGAGCAAAATTTACAACTTTGTTCATTATTGGAATAGCAGTTTCAGTTTTTGACCTACGTAAAGTCAAGAATTTAAGCATATATTCTAAACAGAGATTTTGGTTACGTTAATTTGAATATTTAAAAGGGCAATAAATTAAAGAAAATATATAAAAACAATTCTATTTTAGTGTGTAGAGGACAGCACTGCTCCCAAGAGAATAGAATTTTAATTAGTAAGCTAAGAAAGGAAGGGAAACATAAATAAATTCGAAAAATCTTTGATTCCAATTCCATTAAATATGAATTGAAGCCCGAACCGT CGTGGTTCCATATGTACAACCACAGATATAGAGGATCGACGCATTGTTACTTACAGCAAAGTCAATCCTTTTGCATCCTCTAGGGACGTAAAGACTGAGCTGAACTGGGAAATCAGAGATGGTATAATTTGGAGACGACTACTAAATCAAAATTTAAGTGCGAGGAGTCCACGAATGGCGCCCCTACATAGCCCAAGGCATATTTAGGCACGGTTAAACTTCTCTAAAACCTACCTAAACTGGCCAGTCAAACTGGACTGATGAGTCAAAAATAGTGCTATTTGGTGGAACTGGTTTACCATAGTATGTCCGACGACCTCCACTCACGGAGTACCACCCAAAACACCCACTCAAGACTTTCAATCATGGTGGACGTAAAATCCTGGTATGGGTTTGTTTTCTTTTTACAATGTTATGAGTCCAAAACATTTGATTTATGGTATTATAGACCAAAACGCATATGTAAATATATTTAGTGATGTCCTACTGTCATATACTGAATTCAATATTTCCTTAAAATGGACATTCCAACTGGATAACGATCCGAAACACGTAAACAGATCGGTTTACCCAAAATAAAATGTAGGCAAAAATTACCCCCAAACGTTGCCAGGACCTGGTGGACTCCATGCCGCGTAGGTGTAAGGCTGTGCTGGCAAACAAAGACATTAGACCCTAATTCACACATTAAAAAGGAAAACTAAGTTAGTTCTAAATAATGTTGAATTTTATTAGTATTTTTTCATAGCACTGCTATTTCAGTGAACATTTCTTCCTATTATGTTGTTTTAATCTATATATTCGAAACTATTTAAGAAATAAGACTGAAACATTTGTTGAATTGTTTAAAATTAAATAACTAATAATATTAATATTAATTATATTATATTAGCTTTATATTGTTTTGATTTTGTTCCATATATTTGTTCGATGTGTTTGCCTAAATATGTATTGTATATGTCGCGCAGCGAGTTTCGAACGCATCGAAGGTCTACACACAATTAATTTGTGTCACTCACTTCTTCTCCGTGCTACCCTTCGAACCACA


Search Again