CR00701

CRIMIC CR00701

Gene cn

CG1555

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80627

Images

Construct Sequences

sgRNA sequence
AATCCCTGCTTCCAGATATAAGG

Amplicon 5' Amplicon 3'
AGAGCTCCAGATACCCCGTTTCTATGTACTCCTGGGAGTAGTTGAAGCCCGGCAAACGGACCAAGTGCTGGCGCACACTACTGAAGGCACCATCGCAGCCGACTATAAGATCAGCATGGGCAGCTACGGCTTCCTTGGCGGGATTGCGGAACTCCATGGATCCCTCTCGCAGATTGGCACTTGTCAGCTTGTGCTCGAAGTGGCAGCGTATATTGGGCAGCTTATCGCAGGCATTCAAAAGGACTTCGTTCAGCTGTCGACGTCCCACGGAGTACAGGCATTGATTGTTAATGGGATCGTATAGGACCACACTGGAGTTTCCTCGCACATCGTGGAGCATTCTGCCTCGCATGGGTATGGCGGTGGCCAGCACCTCTTGCTCCAGACCCACGGCGGCCAGCGCCTTACGGCCACGCTGCGAAAGAGCCAGGTTAATACTCCTGCCCTGAACCACTAGGGCCTCGCGGATATCCTCCCGGTACTCGTACAAATCCACGTGGTTGCCCATGCGGGCAAAGTTCAAGGCTGCCAGAGAACCCACCTAGTGTTATGGAGAATAAGATGCGTAGAAAGCGTGATAAGAGC GGAAGCAGGGATTTAAAAACACTAAAGATAACGCATCTAACTACATATGTGAAGACACATCAAAATGCAGCATAATTTAAAGATTACTTAGGAATGATTCGAAAAGAATTCGAATTCTATAATTCTACTACTATGATGTGTATTTTAGCAAATTAGCAAAGCTTAGTTTTAGATATTATGAAGCTTAACTAGAATTATTGCCTGTTTATAACCGTACTACGGTCTACTCTAAATATAGACTATATATTATTTTGTTAATGATTAACACTAAATTTCATTCGCTATATTTATAGACCCACAATCTATTTATGCTTTCGCAGAGTAATAATTGTATACTTCAAATAACTTTGTTACACTCACAAGTCCTGCTCCAATAACCGCCACCCGGCGCCGTCGTCCATGTCTCTCGTCCCTCGCAGCTTCTGTTGGCTCCTGGCGGCCGTTTACCTCCTGGCTAACGATTCCTGGGCTCATGACCGTTCTGCTGGCTCGTTGGCAGCGAAATGAAGATGGAATCGAGATGGAAGCCAGGCAACT


Search Again