CR00700

CRIMIC CR00700

Gene Reps

CG6192

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78992

Images

Construct Sequences

sgRNA sequence
CAAAGGAAACCGTAAACTTCGGG

Amplicon 5' Amplicon 3'
ACTTCCGTGGTATTGGCCTGACCCTGTTTGAAGGACACGTGACGTAGCGAGTCACTGATGGCGGTTACTCGCTTCTCAAAGCTCTCAGCACTGGGCAGCTGACCAGTTTGGGTGGTCAAACCAACAGCTGGAGCCGGCGGTGGCGGCTGCTGGGGCGGCGATTGCGATCCACGTGGCGTTTGCGGCTTTCGGTAAACCTCGAAGGCAGAAACGCGCTGCTGTGCCTGCTGAAGAGTGATTCTTGTGGGCGGCACCACTGCTGCCTGTGGCGGTGGTGCTGCCGGCGGCAAGGAGTGTAGCTGCTGCTCGTCCACCTATAAGGTCAGAGTACCAATTAGTAAGACAATCATACAAATGGATGCGTTTATTTATATAAGCTACTGAATTTGGACACATGACACTAGTGGAGCTACGGCCAATTGTAGTGGAATGCTTTACGAGTTGCATACATTTAGGATTGGACTTACGACGTTCGCGGCGCCTTCGTCGGCAAAGTGCGTGAAATCGGCAAACCCCGTTGAGGTTTGCATATCGAAGCTGGCCTGCGCGGTGATCTTAACAAAAGGGGTTCCATATTTATATACATTTCACAGGTTATAGGTAGGTAGTTAGGCAAAATCAAGCAAACAAAAAACACAAAAACAATATAAGCAAATTCGGTTTCCCGAAGTTTACGGTTT ACGGTTTCCTTTGCAAATGCTTAACAATTGTGGACTCTTAAAAGACACTGTATTTTCATTTCAATAAATTGAATCTGTAGCAAAACTGTATTCGCCTTCATTTGCACAGTACACCACAAATATTGAAAACAGAGACGGAACACACGGAATGTTTTGGAAGTTCCTTAGTTTGTTATAGCATTGCAGGGGATAAGTGCGGATCTACGAAATACTATCCCCTACAAGGCTTTATTTAATGACCAAGGCATATAAAACGACACAGATTGAAATTCTCAGATAAAATTGGAAATTGTTGGTCCATAGGACATAACATACCTCCGCCTGTTGGGCACCGCCCGTTGCGCCTATTTTAAACTTGTTTAAGTCCAGACTGCTGCTCCGTGCATGACGATGTGGCCTTGGCGGTGGCAGAGGCGGTGGCTCCTTCTTCGACGCCAAAGACGATGCCACGTAGGCAGCCTGCGGTTCCTGCGACTCACTTGGCCCAGTGGATCCGATACTGGGCTCGCGTTGCGGTGGCGGTGGCAATGCACTGTTCTTGGCCGGCAGCTTTTTGGCTTGAGGCCGTTGGATGGCACGCAGATCGCTGCTATCGCGGTGGGAGGAGCCAGCGACTCCCGATATTCCGGGTACAACAGCAGATGACTGATTATTGACAGTAGTCGAAGAGATGGCCTTGGGACTATCCTCGCGCTGAGCCACCGCGCTCTCGTTTTCGTTAG


Search Again