CR00699

CRIMIC CR00699

Gene sau

CG7085

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80626

Images

Construct Sequences

sgRNA sequence
TCGCCATAATGGGTCACGTATGG

Amplicon 5' Amplicon 3'
TTCTGCTGCTGGGACTCAAGGACAAGGAGGTGGGTGTGCTCCTTATCTCTTATCTGCTTGGGATGCACTAATTAATTGGTTTCTTTCGCAACATAAGTGCTTCTTCTTCACCTGTTAACCGACGTCTCTCTCTCTCTGTCGCTCTCACGATTTCTCTCTTTCGCAACCTCTTGCTTGGCCCCAAGTGCAACGCAGTCCATCTTCCAGCAGGGGCGTAGTGAAAATTGGATACAGGGGGGTAACTTATCACTTCAGTTATGGGGGCAACAATGTTTATCTGTCCTACAGATAAACATTTTATGCCATGTCTTAGCCACTTCTCTTAGCTTTTCCAGTTTGTTAAGCAATGCACTATGAAATCTTTTGACCAGCCTGCTGACTAATGCGCAATCAGTGAGACTGCCAACACCATTTTCTTAACCACTTTTGTTTTTGCATTAATTAATAGTGTGCTCCATCTGTTAAGGTCTAATCAGCCGTTCATTCTAATCTATAGAACCCATTACTTGCCCTTTGTAATACTTTGATGTACTTCCCAAATAAGTGATGATATATTTATATATAGTATATAATAGGTTTATTTTATGTGTTACACTATCGCGCAATTGCTTCCAGTGCCAAATCAAAAAGATTCTTAGAATTGTTGCCAACGTTCTTAGTTGTTGGAAAGATAGCGCTCTAATACTTCTTCGGTTGGCAGTTGTGGCTATAAATACATACATATCTCTTCGAGAACTTCACTCCGCGCAGCACGGAGAACGGTTTCGTCAAACGAGTTTTCCAATAAGTGGTTAATTTGCATAGGTTTGTAATATTCATAAATCTACGTATAGCGCGGGATGATGTCCGTAAATGCGAACCATCATCCATACGTGACCCATTATGGCGAA CGAACAGGCAGATTCGCATTTCTCCATTGAATTCGGTTTTTATATTTCACTTGGCACACAGCTTTATCGCTCAATTGCTGTTCGCTTGTACCACATAGGAATGCACACATGTGCCTTTGTGGCTGGCACCACGTCTATTTGTTTTCATCATTTTGCCCGCAGTGTATTTGTGTGACCACCCACACCTCCATCCCTGCCACCTCCTCTCCCTTCGCATAAGAGGGATACGAGCTGGAAACAGTGGGACGTGTTGCCCGCTTTTGTTTTACATTCCCCTTCCGAGCGCTCTTATCGCGAAGATTTTGTCCATTTGGTTAATTGTTTGAGGAAGTACATACTATCAAGTGCTGCTCTCCTCTGCCTAGCTCTCATCCGTTTCGGGCTTTTCTTATGTCAGTACGTCACTCATTTTCGAAATTATACAAAGTACTTGGCTTCTACCCACACCATCCATTAGGAAAATTTCAATATCTCGAACTGCCGAACTGATAAGCGACGTGTTCTTTGCAAATGATTCACTTTTATACCTTTCGTTCGGAACGATTCCTTATCAATCATCTGAGCGATTGTTATATAAATTATTTTAAAATCGTGAAATGGCATTGAAACGTGGTTGAGGTATCTATCTATACCTTCCAATTATCATAGCTTTTCAAGCGTTAATAACAAGAGTAATTTTTGTAATTGATTTTTTATGTGGTTATAACATAACTCTTCTTGTTCGTTTTTTCATTTATACTAGCTAGATAAGCATTGTATTTTTTAAATTGACAGTTCATACACTTCTGTGGGCAAGGCCTAAACAAACTCAAGTGTTTAATGTTTTAACAACTGAATACTTTCGTCTGGGAGCTTTACGACCC


Search Again