CR00698

CRIMIC CR00698

Gene Patronin

CG33130

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78991

Images

Construct Sequences

sgRNA sequence
CTTTCTAGGGAGTTGTCTGGGGG

Amplicon 5' Amplicon 3'
CGGAAAAACTCTGGCTGCACTTTGCATTGACTCGCGGGGGAAAAATGTCTAAAACTCAAATTTCAAAAGACCGTGCAGGCAATTCGAAGAAAAACAATAAATGAGTGCTGCTTTGGACGCCCACTATGAATAAACGAACGATGGATGGATGGATGGATAGCATATTTGTATTCAAGCATCCAAATACACACGAAAAAAAAACAATCTAATTTAATGAGAATTAGGTTGCTGAGGGAGTAATAATTAGAAAGCTAATAAACTAGTGTTTTCTGAGATAATTGTTATATTTAAGAAAATAAAACTAAAAATGAATATAATGATGATTTATTGTTGTTCAGTTTAGAGATGTTTTTTCTCTGTGCCGCAAACATTTCCATCACATGTTTGTAATAAAGTTTCAGTTGCTGGTGGTTTTCAAATGTCACAAATTGAAATTGGCGCGACTTTATGATTTCATTATCTAGCCGAACGTTGCTTGTTTTTGGCATTCCAGAGAATGGGCAGCGATATCTGCGGCTAAATATAACAAAGAGTGCTGATGAAGGAAAGCGGGCAAGAAGAGAGTGCTCCGCTTGAGTCAGCGCTTGGATGTTTGAATGTTTGAATGGGTTTAGCCATAGGTTCGGTTCGCGTTATGGTTCCTAGCTGTTTGTTTTTGCTGGCCAAGAACGAGACTCCAGCGCGACTTTCTAGGGAGTT GGGGGAAAAGTCGGTGTACACGCAAGGCCCCAAACCGCCGAGCAGAGTGTTAGCGTTTCTCCCTTTGCGCCTGGCATTCGCATGCGTAAGCCGTTTTTTTTTTTTTTTATTATTTGTTTTTTCTTTTCATATTTAGCGATTAGGTCATGCAACAGCGGCCAGCTCAAAGCGAGAAAAACGATAACAAATGCCTAATCTTGCAGGGGTAAAGCGTATTTTCCGGCTTCGATTTTTCAGCTGCAGTTTTATGAATGGATGTTGGCTGCTGGCATTATATTCCGATCAGCACAAGCACACCCCACACAACTACCGGTTGTAGTTGTTTGCATTGGCCATCGAAACCAGTCGATTGGTAAGTAGGTGTCGGTCGCATACTAAGCGCTAAGTTGCCGAGCGGCATTACCTCAGCGCACCATTTTGGCCAAGAGAGTAGGTGTTTAGGCCCGCTTCGCCTCCGTTGGAATGTTAATGAGTGCTTTTTGTTTTTAGCTCAAATATGAGTTTATTTTATGTGTAACTTTGTACACGGGAAGCCCTCTTGCTGCGCTTACCTGTCGTATTTCCTGTGTTTCGACATCCATGCTGACGGATTTTCCTGCGACGGACTCCGGCTCTCCGACGCCCGCCACTTCACTTTCCGCACTTTTTGCACTTTTCGCACTCTATGTTTGACCACAACACACCGCTTTTCCTTTTTCACTTGTCTCTTTTCTGCGTGCGAGCGAGTGCGTGTGTGTGTGAGTGTGGCTTGGAGTTTTCCTCAGCTTAGGTGATTTTCACTTGGAGCCTAAACACAAGAAAATACAAAAACACGATTGGCACTTTGTCAAACCACTTGGAAATCGAGAAAAATAACTAATTGCGCACACGCATTGTCAGCGAATTTTTTTCGGCGGGCGGGGCAGGGAAAAAGCTTAAAAGGCAGGCGGGCAGCCGAAAGAAAATGTGAATCATTCACGGAGCGCGACGGTGGGTGGTGGGCGGGGGCGGGGCTGCAGTGCGACAATAACAGAGAACACTTTACAGTTGCCTGTTCGCTTTTCTCGAGATGCTGCTGCATCAGCTGTTGCGATTTGCTCGTCTGGACAAGCCATTTACGCACTTTTCAACCCATCGCAGTGTTCA


Search Again