CR00697

CRIMIC CR00697

Gene retn

CG5403

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78990

Images

Construct Sequences

sgRNA sequence
ACTGCTCCTATAGCTCTTGTGGG

Amplicon 5' Amplicon 3'
ATGCGGCAGGACAACACTTAGGGACCAAAGGCCGTCCGTGCAACGGGATCATGTCCATATAAATTTTAATGTCCACTGGAACCTTTTTGCATCCATATGCTAGGGCAACTATATCTGTATCTGATAGTTATAAATTACACCCACACCCACACACACACACACACGGGGGCAGGCAAAGGGAATTGATCTGGCGAAATCCAGAATTCCCAGAATCAAGGATTCAAATTTCAAGCACCCAGGCAGCGGATTTGTCGGGTACTAAGTCTAGGCGACAAATAAGTGAGATTATTTTTATAACCCGAACCCAGAACCCCGAATCCCAATTCCAGATTCCCAGTTCACGATTCCAGATCCCGAAGAAACATGTGTGTGCTCAGGCAGCGGCAGCAGCATCTTCGATAGTTATAAAAACGATTATGATTGGTCTACGGCAAACGTGGCAGGGGATAGAATTCTTGTTTGCCGGTTTTATAACTTTATTGCTACGGATTTGGGAGAGATATTGGTAGCGCTTAACGGTTTTGCGGCTGCTGTGATGCAAGTTCGGGGATCGAAATTCGGGAAAGATATTGGTAAATGAGGCACAGGCAGGTTTGCAACCCTTGTGCGTGAAAGCGAGACTTCATTTTATGATTATTAATACGAACGAGTACCCGAGTACCGCAGACAGGCAGGCAATAATGTAGGTACACAGATACAACACATGTGTGTGTGCGTGTGTGTGTGCGGCGGCAGCGACGCAGGCAGCATTTCGATCCAGACTCCTGCCACAAATTTAGTTGATAAACGACCTTTGATGGCGTTGCATCGTCGCGTTGATCAATGAAATAAATCGAAGACTGCAAGTGAAATATAGTTCCGAAATCGGGAAATCATCTCAACAACAAGTGTGAAACGAAAGCATCAGCTCAAAATGCTCATCTCCGAAGATCAAATTCAGGAGGTACATCCACGTGTATAATGTACATATAAGGTGTAATCAGTGAAAAGCAACGAATCCTTCGAGGAACCAATCCAGTTGAATTTCAATTAATTTATTTTGTGTTTGGCTCAACCCCGAGCGGTATAAAGCCACATATGTATATATGAAGGTTTTTTTTTTATTTTGTTGGCACTGCTCCTATAG TTGTGGGCGTCGAGAATCATAAAAAATATCCCCAGCCCAGCCAGTTTGGAAAGAAGTTGGCAGAAGGATTGGAGTCCAAAGTGCCCGGCCAAAGTCGGGGCTCCAAGTCTGACTTGGTTTTAAATCATTTATGCGAGGAGGTGGAGAGGCGAAAGGAGATGGAGAAGGAGGCAGTTCATCATTCGCATTGACTTAGAATGTGCACCACGGATGGTGCAGGGCTCCGTCTGTAGCTCCGTCTCCATCTCCATCTCCATCTCCAGCTTCGTTTCTTTCTTTTTGCAGTAGGCGGAAAGTATGATGAATTCCGAATTTGATGAGTTCACTCCGATGTTGTCATTAATTCTGAACATACTCGTACCAAGTTGTGACTAGGGTTTTTCCTTCCACGGACTTGGTTCCTGGTGGCAAAGGTCAAAGCATGAGCCGCAGGAAAAACGCAGCACATAGCGACGATAAATAATAATGTATAAATGGCAGATACATTTATGTACTTCCCTCGTTTGTATCTCCGGCTCTATCTTTATCACCTAATTATCCGTTGTGCCACTCGCGCGCCCATTGAGCTCTTCACACTCTAACAAAAGTCCAAAGAGGCAGGATTGGAGGGTTAGG


Search Again