CR00694

CRIMIC CR00694

Gene CG34313

CG34313

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78989

Images

Construct Sequences

sgRNA sequence
AGATATCCGTGCCCGTTACGCGG

Amplicon 5' Amplicon 3'
TACGCAAACAGGCAGTTCGAGAGGCTCGCAATAGAAACGAACCAATTCTCGGAAAGAAAAAGAAGCGGAAGACAAATCCCCGGTTTTTTAGGACTGCCCGCCGCCTGCGGAACGACTTTGATCGATCCGAACACAAAGCCATGTTGGCCAGCACTTCCGAGGAGCTACGACGCATCCTGCAGGATGTTGAGACTCTCTCGGACATTCCGCACGATATAACAAACGTCGAACTGCAAGGGGAGGTAATACCCAGTTCAACCCGCGGAGTAAAACTCCAGGCTTACAATAACTTTTATCTAAAGATGTACTGGCTAAGCTCTTAGTATTAGTCAGCATTATTGTTATTAACCACGTATCAAATTTACATATTTATTTCATTGTTGTGCTTTCCTAATCAATTTCTTGCAAAAGTTTTTCCTTTTATTTGTTAATCGTGTCTTGACGCACTCTCGAACATTGTACAAATGTCGGTCAATCATTTTAATGCTCCTAATTCGACATAGTTCCAGTTAATTCCACATTTTTCGCAAATTGACGTTCAAAACGCCTTAATCTGCATAATAAAAGACTGCAAATTTTTGTTTACTAAAAGAGATTTTAGTGCCTATTCTGATTGAAAAAACTAGATCGCCTATAGGTCCATCAAAGTGCAAATATCATTAACAGCCATAAAGTCTTCCATACAACCAGTTACTCCTCCAACCCACTAATACCAGTTGCAATTAGCACTTTGGGGTGTTCGTTCTTGCGATGCTTTCGTCACCGATATTGGCCATTGAATACTACTGACCTACTGCCGTACAATCAACGTGCTAATTGATGGGCTTTTATTATGAAGATATCCGTGCCCGTT GCGGTTCTATTGCACACTGAACATACTACAGTTTCCACATATTTCACAATTCCAGATAGCCATCGCCGAGGGACGGGCCACAACGATCTATGTGCAGCGAGATGGACTCAGCACCCTGACAGTGGTGGTCAGTATTTCCTTGAATTGATTTATATCGCAGCTGCTTGCACTTGCTGTCAGTAACATCGTCAATTGGCGCCTCAGAAGCTTGAGCTCTGGCTGAAAGTCATGTATAATAAGGCAGCGAAAGTGTGTCAGAACCTTCTAACATTCTTAAGATGTTCTCCAGTCAATCTACTAGTATTATTCCATTTATTTAATACCTATTTAACACCCTTAATCTAAAATCTTTTAGTGTTAACCATTTTTACGCGATTTTCTTGACTCCGGAATAGCTCTATCCTAATTTAGTTATCCCTTAGCTTGGCTTAAACCTCTCCCTTAAACTCTCTTGATATCTCTTGACAAACGTTTTTTCTCTAACTGGTCGCTTCCTTGCAGCTCCACCAGCACGAGCCCACGATCGCTCAGCTGAAGAGGGCAATTGCTTTGATCTCACGGGCCCAGCACAAGCGCAGCCAACGCGAGCGGTGCGAAGAGCGTCTTCGTCGTCGGGGAATCGCCGACGACTCCGACGAACGACGGCAACCAGTTGCGGTGGCCAGCTCCACCGGCGAGTTAGTTCACTCCGCTCAGCGCAACGGGCATGATCATCGCGCGTTCGTCTCGTGGCGGTTTCTATGGCGCTGTTTTGGACTGCTCAACGTGGACACGAATCAGCCGATCGACGACCAACGCTCCAGCGGCAGGGCTACTTTAAAGGAGCTGGGCATTGAGAACGCAGCCACCCTAAAGTTCGTCCATCGCGTCAAGTATTTCGGTCGC


Search Again