CR00693

CRIMIC CR00693

Gene Nox

CG34399

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78988

Images

Construct Sequences

sgRNA sequence
ATTACGTGGGTCAGCCACTGGGG

Amplicon 5' Amplicon 3'
GTCTCGGAAAGTGACGCTCTGGAGCGCCCTGACCTTGTGCCACTTATTCTGTGGTCCTTTACCCGATCGCTGGTCGATCGCAAAACCCGTTTTTGGGTTGCTTGATGGGCTCAGCTTTTGCTGAGCTGGTGTTTATTTGGTTTCGGCTCCGTACGATCGACCACGAGCATTTTGTTTTTATGGGCTCCCCGAAAGCCGTTTAACCAGTCAGGGCTCATCCGTTAAATATGCACATTTTTCATCATCGCCGGGGGATGGAAGATGGGAGATCGCCACAACAACTGTGACCAAATGCAAAAGACCCAGCGCTGCGCTTCGATTTGCAGACAATGCTGGGCGCTCATGGATCGTGAGCTCGAATGCCATTAAGATATTAATAAGCGTCTAATTTATGCCATTCGTCTTCATCACTACCGCATAGTTCGATTCCCATAGTTCGAATCACCCCATAGTTCCCAGTCGTGGGACCAGAACACTCTTGATTATGCTCATTACGTGGGTCAGCCA TGGGGTAAACACTGTGCTCCGTGCACATATATAAATCTTTGGTTGCGGGGCATAAACAAATGCTTCTACAAACAATACGAACGTAAATTAATTAACACTTGCCCAGAAACGGGAGACGCATAAATCCCAGCGGTTTACAACTTGTTTTTCGGTCTTGCTTACAGGAATTCCAGCAGAAGCTCTTCCAGCTGTTTGATCTCGAGCGGAATGGCTATCTCCTGCAAGATCGCTGGATCGAGCACCTCAAGGGTCGGCTAACGTAAGTGTGGGTTGGTTTGCTGGCGAAGGTGGAGTTGCTTCCTTGGTATCCTCCTGCTCCTCAGAGATCGCTGCTGATGATGTTGCGACGGTGCCAAAACAATTAGCTCGCCTTCGGAAAGGCAAAGAAATAAAGAAAAAATAGCCATACGATCGAGTCCGATCCACACACGCACCTGGCTGGCGTGCTCCAGGCATTCCATTCCAGCTGCGACGACCAGAAGCCCCATGCCACATCACATCGCAGCCCCAGATGCCAGATGCCAGCTCCGTTCCCAGACGATGCCGATGTCCGTTGCCCATGGCGATGCTATCTGCGCCGTGTGTTAACATATACAACAGCTAACATAGTCCGCGTGCCTC


Search Again