CR00691

CRIMIC CR00691

Gene Sox14

CG3090

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78987

Images

Construct Sequences

sgRNA sequence
CGCTCATACCGCCTTGTCTATGG

Amplicon 5' Amplicon 3'
CGGCGACATTGAGAGTGAGTTTCGGAGCAGAGTTGCGAGGGCAAAGGCAACAGAACGGCAGTGGCAGTGGCAGTGGCAATGGCTGAGCCAATGGCCGATGGAGCATCGCATCCCGTCGGCCCCAATACCACGTCTGCTCCACTCAGCCCGCTCAGCGTTCGGTTCGGTTCAGCTCGGAGCGCCAAGGGTATCGCCTCTGCTTCGGATGTGGATGAACTCGCGAGGTGCACGAACTGCTGCAAGGTCGAAGTTAACGCTATTAATAGGTGGTTTCTGCCGTCTCTCGCGGCGCGAATAAAACGGTTATTCACATTGGCCAAACGAGGCGGCGCGTCACCGCAATGACCTATTCCAAGTCACCAAGTCAGTCTTCCTGGCCTCGCGAGCCCAGTTTCCAGATGAGTGCCCACCTGAGATCGGGCTGGATCGGATGTTTGGATTTTTGGGATGGTCAGGATGCTTAGGGATAAGTTGGGACCAGAAGAACGGGGCAACCAGGAAGCGGACCCACTTGTCCGAGCATCGCAGCAGCCGCAACCCGTCGAGCAGAAACACATTTCAGTACAAATGCACACAGACACAAGCCATATTTCGTTTTAGGAGCGTTTTATTAACCTTGGCGAGGGACATTGAACTTCAAACGCGGCGGATACGTATTTCGCACAGATACAAACGCCATAGACAAGGCGGTATGAGCGAAA ACAAGGCGGTATGAGCGAAAATGAGCGATGCATGTATGTCGGGCACACAGCCGAACTGTTCAGATGTACTATATACGCATATATGTATATATACTATATCTGGCGTGAATTTGTTTCCTAACTCTTTATCTGCGATACGTTAATATGCAGTCGGCATTTATATATATTATTTATATGCGCAGGTACAATAGGTAAATGTGTTTTTCGCATGAACGAATTAACGGAGCGTATCTGCGGTTGCCGAAAGGTAAAGCAAATTTCGTTGTTCCATAAGTTGGTGGAAACAAGGGAGTGCATTAATTTACGGGCTCTGAAATGCCGGAAGTGAATTTAATATCGTACGGGCGGCCACATATGTATTACTCACTCACTTTCCTTGCGTTGCACTTGACGCCTTGCCTAGGCCAACATCTGTGGGCTTAGCGCTGTGTGGGGATCCCGCCCCCACCCACTCACAATCGCATCTAAGATAGTTATAACTAGCTATAAGATTGAGGCAATAACTAAACCGCCTTCTTTTCCTTCCACCTGCAGACCAAGAAACATTCGCCCGGCCATATCAAGCGACCCATGAACGCCTTCATGGTTTGGAGCCAGATGGAGCGGCGCAAGATCTGCGAGCGGACCCCCGACCTGCACAACGCCGAGATCTCCAAGGAGCTGGGCCGCCGCTGGCAGCTGCTCAGCAAGGACGATAAGCAGCCGTACATAATCGAGGCGGAGAAGCTGCGCAAGCTGCACATGATCGAGTATCCGAACTACAAGTACAGGCCGCAAAAGAAGCAGACGCGCTCCCCGGGATCGCTGAAGCCCAACCAGGACGCGGACGGCTGCGAAGCCAGAAATGACACGACCAACAACAACAACTCACTGACCACACTTGCAATTAATGGAACCACCACTGCCGGCCGCAAAAGCAAAAGATCTACCTCTACATGTCAATCGGGTTCCGCTTCGAAACGATTGAGGAACGACTCGGGTGATACCTCCTCCAAGCCTAAGTACGAAGTTAAGATGGAGTCTGCTGAGCAGCTCAACTCCGCCGATATTATACTACCCTCAGCCGATAATCTGATAAGCTACCAATCGTCTGAATACTTACCTCTAAGCACGCTCAGCAACGCCGACTGCGACGAGAAGCTGCACTCTGAGCTGA


Search Again