CR00689

CRIMIC CR00689

Gene RpS27A

CG5271

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78986

Images

Construct Sequences

sgRNA sequence
GTTCATTCAATATAGGGCACTGG

Amplicon 5' Amplicon 3'
CAATCTGCCCATCATTGGCGTCAAGAAGAACCCCAGCTCGCCCATGTTCACTTCCTTGGGTGTAATTACAAAGGGTACTGTGATCGAAGTCAACATCTCTGAGCTGGGTTTGGTAACGCAAACGGGAAAAGTTGTCTGGGGCAAATACGCTCAGGTCACGAACAATCCAGAAAACGATGGTGTTATCAATGCAGTGCTGCTTGTCTAACCCCGAAAATGTCGCTACCTAATTTAAGAGTTTGATTTAATAAACAAACATATACAATAACATGAACAATCGTTTGATTCTCTTAGCTTATTATACTATTAGCTGTAGCAATGCCATATATATAAACACACATATCTATACCAACATCTTTTTGTTTCTTGCAGTTTGGTGACTGGAATACAAGATGCAGATCTTCGTTAAGACCCTCACGGGCAAGACCATCACTCTTGAGGTCGAACCGTCGGATACTATCGAAAATGTCAAAGCCAAGATTCAGGACAAAGAAGGAATTCCTCCAGATCAGCAGCGTCTGATCTTCGCTGGCAAGCAGCTGGAAGATGGCCGCACCCTCTCTGACTATAACATTCAGAAGGAGTCCACTTTGCACTTGGTGCTCCGCCTGCGTGGTGGTGCCAAGAAGCGCAAGAAGAAGAACTACTCCACTCCCAAGAAAATCAAGCACAAGAGGAAGAAGGTCAAGCTAGCTGTCCTGAAATACTACAAGGTACACACAACAATCTACCGACACCATACCGAAAACATTCTGATCTGTTCTTGGAATTCTTGAGTCTTGGTCTTGTGCTCATTGGCTTAAGATTTGGATATCAGAGTGACTTTACCAGTGC TGAACATGTGTACGATCTCAGTATTTAATCACTTTCTATGCTCTTTCCTTTCCATAGGTTGACGAGAACGGCAAGATCCACCGTCTCCGTCGCGAGTGCCCTGGTGAGAACTGCGGCGCCGGCGTCTTCATGGCTGCCCACGAAGATCGTCACTACTGCGGCAAGTGCAACCTGACCTTTGTCTTCAGCAAACCAGAGGAAAAGTAATTTTGCTACATAAGATCATGTACGTTTCCAGAAATCAAATAAAGGTAGTAATTGAATAATAAATTCAATCGCTGAAATTTTCCTTTTTTTTTATTGTTAGTTAGCACTAGCGTGGTTAGTAATTGTTTAGCAAAACACTAAAGTTTCATTTAGGGTGTATGGTTTATTTGTGAAAATATTGAATACATTTTGTATACTCGATTTTTACTCGACCTTGAGAAATGCAATTTGTTTATGGTTAACCACTCAAACGTTAACTATGTCGACGTTAAGGCTTTTGGACAAGAAAGTCAGTATATCGGTGGCTTCCTCGATTCTCTTCGATGTCGGCTTGCCAGCGCCATGGCCCGCCTTCTGGTAGACGCGCAACAGAACGGGATTTT


Search Again