CR00688

CRIMIC CR00688

Gene Chd1

CG3733

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78985

Images

Construct Sequences

sgRNA sequence
TCTAAAGTGCGACCTCACTCTGG

Amplicon 5' Amplicon 3'
CTGCTGCTTGTGTTGGCATTGTTGATGCTCTGGTTCCTTTGATCCGATGGGCCCTCGGCGTCTGAATCGGAATCACTGCCACTAGACCCGTCACTGGAGCTGTCCTCCTGGTCATCCGTGAACCCGTTCGTCTTACTGTCCGCCTGGGCAGCAGCGGCTGTCGGTGGAAACCCTGCCACCGATAACGATTTGTCCTCGGGTTCTGGGGAGCTCCGTCCATCGCTAGAGTTGCCCGAGGAGCTGTCTGAATCTGAGTCTGAGCCGGAGGAGCCACTACCGCTGCCACTGCCACTATGGTCGGTGCCATTGGCCTCTTCCCGAGTGTCATCTTGTTCGTCTGAGCCAATACTATTCGCCGATTCATTGAGTGCCTGGTCAGATGAAAAGTAATTTCAAAATCAATCTAGGTTGAAGATCAATCAATCTTAGTTAAAGATAAACCGTCGGATACGAAAAGGTTGAAGTAACACACCGGCTCTGGGCCAGCCAATCCTGGCCAGAAATTGTGAGTACAGAGTGCATCGAAATTGGCATAACATGTTTAATATTCCCCTTATTCAGCTCCTTAGAAGTAAGGAATGGGTTACACAATCACTGAACTATAGGCAACGACTTAAAGTGACATTTTAAAACAAGAAGATGGCTCAATCCTGTCCAGAGTGAGGTCGCACTTT AGGTCGCACTTTAGATTCCACAAAAGCCTGGTAAAACCACGGAAAACTTCGAAAACTTGGCTCTTGGGCCGTGCTGAACAGATTATAAAACAAAACGGCGTGAAGAAACTTTCATAAAACGCACTCTCATGGCTTACACAGGACTAATCCTCTCCAGAAATTTGTTTATGGCAGTTTTTGGCCAAAAAGGGTAAAACAAAATGTATTGCGTTTTGTAGTTCCAGGAAGCACACGACAGAAGCACATGACTACTTTGAAGAGAACGCGGTAATCACACGACACTTCTTCCTGGTGATTAGAAACCCGGATATCCTTAGAAACAAGCGGGAAATCGATGTTCTGGGCGGGATCTTTCCCTGAAAAAGGCACAAAACTGTGGAAATAGGAATGGCAAAGCGGAAAAAATTATTTTTAATCATTGTATCTGTCGAAAAGAGGAGGAATTTAAGGAAAATTATTGCTGGTAGCCTTTTGGCGGGCTCGAAAATCCCTGGAATTTGGTCAGAAGTACAAGAGAGGAAACTTTGCACCTAGCCATTTCTGATTACGTAATCGGTGAAAATTTTCCATTTTATCGAAAAAGGAAGGAAATCCATGGAAATTACAGGATTTTAACAGCCGCTATTGATAAAAACAAACAGAAATTCTTGAATTTGAGTAGAATTTGCGAAAATGGGTACCCAATGGATTTCCACAAAATCCACCTTGGCTGCCACGTTGAAGCCTTGGGAACTGTCAGGCACTGTCGGAAGGATGAAACACTCTCGGAATAGTGGAGAAATAAATCCTTTTATCCAAATGCTCCGCCAGCAGCCGCACGGCCAGTCATCAAAGTGT


Search Again