CR00685

CRIMIC CR00685

Gene Gprk1

CG40129

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK80625

Images

Construct Sequences

sgRNA sequence
CGCCTAGTTAACGTCATACGCGG

Amplicon 5' Amplicon 3'
TTGTGTGGCTTGCGACAATGTTCGGCCGTGTGGTCAAACTTCTGACATCGATGTCATTGTACTACATCATTTTTCCATTTTTGCGAGCAGTACTTATGGGCCTGCGTGCAGCTGCAGTTCATGAAGCTCCGAATAATAGACAGACTTACAGGATGGTGTTTGGGCAAAATCATTTGGTGTCTAGCATCGTATGAATGTGAAGAACTTTCCACACGGCCGCCAACGCGTAAAGTGTCATTCTCATCCAGAAAGGGCAGTAGCCACGCAATACAGCTCGAGTTTTTGACAATTCCCTTAGAATGCAACTCTTTAATTTTGTCGTTCGTTTTACTTCTGTGTGCAATATCGGAAACCCAAAGCCAATGATAGCGATTCACTCAGTAATCGATATTACGCCTCTAAAGAATTCGGGCGGTGAGCGTGGAAGCGGGTAATGAGGGTCAGGCGGTAGCAGAAGATGGATATGAGACGATGAGGCTGAGATCAGGTGAGACGAGAAGACTGCGATCAGGAAGGTCCAGGACAACGGAGGGAGGCTAGAGAAAGGCGGAAGGATGTGCGAGATGCCAAGTCAAGACGCTAAACGACAGGGTCTACTAGGCTGAGACTGAGAACGAGCGAGGGTCTAGGGTCTACCTTTGTGAAACCACCACACTTAAAAAAAAAACCCACACAAATACATAGGTTAATTGCGAAAGGAACATTGAGGTCCAGTAAGACGCCTGGCTACACAACTAATTGATACCAGACACTGGCGTTAGCCCGGCGAGTCCGTTAATGTATGAACAGGCGTGCCCAATCCTAGCAAAGACCCGTTCCCGTGGCGGGATTGTGGTAAAGATCCGGTCGACGGTTTCAGTGTTTGTGTACCGTAAACCAGACGATTGCCTTTAGCATGCGTAAGAATGAAAGACGCTACTGTTAATCCGCGT TAGGCGTCTTGGTACAGGGACTGTGGCGTAAACCGGCGGATTCCACGGAGCATCTGTAAGAACTGAGCAGGGGTCTGGCGGGACCGGTCCGAAACCAGTGATTTCAAGACAACAAACCAAATACTCCACTTACCAAGCTACGACGACATACTCTGGCAAACCTGAACACCCCCAACAAGCTACTACAGACGATGACATGGACACTACCGCAGCAATTTCACAAATACATAACAAAAAGAACATGATTGATTCGGCGCGTAAGCTCAAATCCCATACAAAAGACAAATCAAGCGTACTTAGTAACCCACTTGAATCTTGAAAGACAAAACAGAAAAATCAATTATCCCCATCAGCAATCTCATCAACAAACTACCACAAACAAACCCCGTACAGTACTCGTACTGAGGCTTAATAGAAGGAAACCGAGCGACCTCAATCTTCGATCTCCTTCAAAAAGGGTCAGTAGACACTGTCATTTATACAACTTTTATCTGTTATTGTCCCTTTTTGTTATTGTTGTAATTTATAAATTTCCCATCTGCATATAATCATCATCCATGGCAACCGAACAAGTCAAACTGTTATCGGAATCCCATCTGAAACAAGCCTTAATCCAAATTAGACAAATACCAACATTCAGTGGTAATAGCCAAGAAGTCAGTGCTTTTTTCCGAAGGATCGAGTTCATACTTCAGCTATATCCATCAACCGACACCAGCATGTATTCTTCAGCGCAATTGAGATGCAACTTGCAGGAGATGCTCAACGAGTATCCCAATTATCCAGAGCAACAACCTGGCCAACCCTTATGAATGCGCTCATCAGCGAATATAAAACCCAAACACCATGTGTAGAACTACTCTGTCGTCTCTACAACACACCCTTCAGCGG


Search Again